
13.6 : Intégrines - Biologie

13.6 : Intégrines - Biologie

We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Les intégrines ont jusqu'à présent été introduites comme récepteurs de la fibronectine et de la laminine, mais il s'agit d'une grande famille avec une grande variété de substrats. Par exemple, l'adhésion focale (Figure (PageIndex{8})) montre un récepteur d'intégrine lié au collagène. Comme déjà discuté dans le chapitre précédent, les adhérences focales sont généralement transitoires et considérées comme des points de contact lorsque les fibroblastes ou d'autres cellules migratrices rampent sur une boîte de culture ou une lame recouverte de protéines ECM.

En plus du collagène, les fibronectines et les laminines sont également des partenaires de liaison potentiels pour les intégrines. Comme le montre le tableau 1, la diversité des sous-unités et des combinaisons signifie que les intégrines sont impliquées dans un large éventail de processus cellulaires et peuvent se lier aux protéines de surface cellulaire ainsi qu'à l'ECM.

Tableau 1 : Récepteurs d'intégrine, leurs ligands et leur distribution.
1β1principalement des collagènes, également de la lamininerépandu
2β1principalement des collagènes, également de la lamininerépandu
4β1fibronectine, VCAM-1cellules hématopoïétiques
6β4lamininecellules épithéliales
Lβ2ICAM-1, ICAM-2Lymphocytes T
llbβ3fibronectine, fibrinogèneplaquettes

Avec cette variété, il n'est pas surprenant que toutes les intégrines ne se lient pas aux séquences RGD, bien que la plupart le fassent. Par exemple, les intégrines α2β1 préfèrent les séquences YYGDLR ou FYFDLR, et αIIbβ3 se lie fortement à la fois à la séquence RGD et à une séquence KQAGDV. Il a été démontré que l'activation de l'intégrine initie des voies de signalisation, en commençant par la kinase d'adhésion focale (FAK) ou quelques autres kinases centrales, qui contrôlent les activités du réarrangement du cytosquelette à la survie cellulaire.

Les sous-unités α et sont des protéines transmembranaires qui ne traversent la membrane qu'une seule fois. Au cours de l'évolution, ils ne se trouvent que chez les espèces de métazoaires, mais ils se trouvent également dans tous espèces de métazoaires. Toutes les intégrines sauf une, α6β4, se connectent au cytosquelette du microfilament d'actine via le domaine cytoplasmique de la sous-unité b. L'intégrine α6β4 se lie au cytosquelette du filament intermédiaire, en partie parce que le domaine cytoplasmique β4 est très grand et s'étend plus loin dans le cytoplasme. Du côté extracellulaire, il existe un site de coordination des ions métalliques habituellement occupé par Mg2+, qui est nécessaire pour la liaison du ligand. Il existe également plusieurs autres sites de liaison d'ions divalents. Le récepteur peut être soit dans un état inactif (un peu penché vers la membrane) soit dans un état actif (redressé). À l'état inactif, la sous-unité a se lie à la sous-unité , empêchant étroitement l'interaction avec le cytosquelette. Cependant, une fois une sous-unité du domaine cytoplasmique, elle déplace la sous-unité a, provoquant une légère séparation des deux sous-unités et conduisant à l'activation du récepteur. En effet, les intégrines mettent en évidence ce que l'on appelle la signalisation « inside-out », dans laquelle un signal cellulaire (issu par exemple de la cascade de signalisation d'un facteur de croissance) entraîne des altérations du domaine cytoplasmique et qui décale la conformation du domaine extracellulaire. à un état redressé actif dans lequel il peut plus facilement se lier aux ligands. C'est pourquoi les intégrines sont si bien adaptées aux adhérences focales et autres adhérences « en mouvement » qui doivent adhérer et se libérer rapidement. Bien que le recyclage des récepteurs se produise également, leur activation ou désactivation par une signalisation inversée est un mécanisme efficace pour un mouvement rapide.

Comme on peut s'y attendre d'une structure liée à l'actine, les adhérences focales et leurs in vivo les équivalents sont des points de contact transitoires et dynamiques entre la cellule et le substrat sur lequel elle rampe. Cependant, il existe de nombreuses situations dans lesquelles une cellule n'est pas seulement stationnaire, elle doit être fermement attachée à son substrat afin de se préparer à tous les facteurs de stress qui pourraient venir tester sa résolution. Dans ces cas, le cytosquelette d'actine est trop éphémère pour la tâche.

Activités de recherche

Notre recherche vise à comprendre comment les cellules réagissent aux changements de propriétés mécaniques de leur environnement environnant. Nous combinons des approches de biochimie, de biologie moléculaire et de biophysique quantitative pour étudier les mécanismes moléculaires qui contrôlent la structure et la fonction nucléaires en réponse à un stress mécanique. Les projets récents portent sur : Comment le nucléosquelette régule l'expression des gènes dans les cellules vasculaires et dans les progéniteurs neuronaux, et comment la transmission intercellulaire de signaux mécaniques régule le comportement collectif au sein de l'épithélium.


Christophe Guilluy, PhD (Chef de Groupe) [email protected]

Aureille J, Buffière-Ribot V, Harvey BE, Boyault C, Pernet L, Andersen T, Bacola G, Balland M, Fraboulet S, Van Landeghem L, Guilluy C . La déformation de l'enveloppe nucléaire contrôle la progression du cycle cellulaire en réponse à la force mécanique. Représentant EMBO. 2019

Guilluy C , Osborne L, Van Landeghem L, Superfine R, Garcia-mata R et Burridge K. Les noyaux isolés s'adaptent à la force et révèlent une voie de mécanotransduction au sein du noyau. Nat Cell Biol. 9 mars 2014. doi: 10.1038

Guilluy C, Swaminathan V, Garcia-Mata R, O’Brien ET, Superfine R, Burridge K. Les Rho GEF LARG et GEF-H1 régulent la réponse mécanique à la force sur les intégrines. Nat Cell Biol. 2011 juin13(6):722-7

Guilluy C , Burridge K. Mécanotransduction nucléaire : forcer le noyau à réagir. Noyau. 20156(1):19-22

Collins C, Guilluy C, Welch C, O’Brien ET, Hahn K, Superfine R, Burridge K, Tzima E. Les forces de tension localisées sur PECAM-1 provoquent une réponse globale de mécanotransduction via la voie intégrine-RhoA. Curr Biol. 2012 novembre 2022(22):2087-94

Thompson WR, Guilluy C, Xie Z, Sen B, Brobst KE, Yen SS, Uzer G, Styner M, Case N, Burridge K, Rubin J. Fyn activé mécaniquement utilise mTORC2 pour réguler RhoA et l'adipogenèse dans les cellules souches mésenchymateuses. Cellules souches. 31 novembre 2013 (11) : 2528-37

Sandrine Fraboulet, PhD (Professeur agrégé)[email protected]

Publications sélectionnées

V. Mercier, M.H. Laporte, O. Destaing, B. Blot, C.M. Bloin, K. Pernet-Gallay, C. Chatellard, Y. Saoudi, C. Albigez-Rizo, C. Lamaze, S. Fraboulet, A. Petiot, R. Sadoul. La protéine-X interagissant avec ALG-2 (Alix) est essentielle pour l'endocytose et la signalisation indépendantes de la clathrine. Rapport scientifique. 2016 (6):26986

Chassefeyre, J. Martinez-Hernández, F. Bertaso, N. Bouquier, B. Blot, M. Laporte, S. Fraboulet, Y. Couté, A. Devoy, A. Isaacs, K. Pernet-Gallay, R. Sadoul, L. Fagni, Y. Goldberg. Régulation de la fonction post-synaptique par la sous-unité ESCRT-III liée à la démence chmp2b. Journal des neurosciences. 2015 18 35(7) : 3155-73. Erratum dans : J Neurosci. 20 mai 2015 35(20) : 8035-7.

Chivet, F. Hemming, K. Pernet-Gallay, S. Fraboulet, R. Sadoul. Rôle émergent des exosomes neuronaux dans le système nerveux central. Physiol avant. 2012 3:145.

Briese, B. Esmaeili, S. Fraboulet, E.C. Burt, S. Christodoulou, P.R. Towers, K.E. Davies, D.B. Sattelle. La suppression de smn-1, l'orthologue de Caenorhabditis elegans du gène de l'amyotrophie spinale, entraîne un dysfonctionnement locomoteur et une durée de vie réduite. Hum Mol Genet. 2009 18(1):97-104.

A.L. Mahul-Mellier, F. Strappazzon, A. Petiot, C. Chatellard-Causse, S. Torch, B. Blot, K. Freeman, L. Kuhn, J. Garin, J.M. Verna, S. Fraboulet, R.Sadoul. Alix et ALG-2 sont impliqués dans la mort cellulaire induite par le TNF-R1. J. Biol. Chem. 2008 283(50):34954-65.

Monika Elzbieta Dolega, PhD (Associé de recherche) [email protected]

Publications sélectionnées

Dolega ME , Delarue M, Ingremeau F, Prost J, Delon A, Cappello G. Des capteurs de pression de type cellulaire révèlent une augmentation de la contrainte mécanique vers le noyau des sphéroïdes multicellulaires sous compression. Nat. Commun. 2017 janv. 278:14056. doi: 10.1038/ncomms14056.

Dolega ME , Abeille F, Picollet-D’hahan N, Gidrol X. Culture 3D contrôlée en microbilles Matrigel pour analyser le développement acinaire clonal. Biomatériaux. 2015 juin52:347-57. doi: 10.1016/j.biomaterials.2015.02.042. Publication en ligne du 3 mars 2015.

Dolega ME , Wagh J, Gerbaud S, Kermarrec F, Alcaraz JP, Martin DK, Gidrol X, Picollet-D’hahan. La fabrication facile sur paillasse de microcanaux circulaires fermés fournit une structure confinée en 3D pour la croissance des cellules épithéliales de la prostate. PLoS One. 2014 juin 199(6) : e99416. doi: 10.1371/journal.pone.0099416. Collection électronique 2014.

Lydia Pernet, PhD (Ingénieur) [email protected]

Responsabilités au laboratoire :

– Expériences en biochimie, biologie moléculaire et cellulaire
– Maintenance de la ligne de culture cellulaire
– Développement des expériences ATACseq

– Biologie moléculaire -> qPCR
– Hygiène et sécurité à Prévention Assistant et secouriste au travail

– En charge de la maintenance de la salle de culture
– Encadrement des étudiants
– Responsable des achats

Découplage de l'adhésion et de la signalisation des intégrines : lePS domaine cytoplasmique est suffisant pour réguler l'expression des gènes dans le Drosophile embryon

Les récepteurs de surface cellulaire d'intégrine sont idéalement adaptés pour coordonner la différenciation cellulaire et l'assemblage tissulaire au cours de l'embryogenèse, car ils peuvent médier à la fois la signalisation et l'adhésion. Nous montrons que les intégrines régulent l'expression des gènes dans l'embryon intact en développement en identifiant deux gènes qui nécessitent la fonction des intégrines pour leur expression normale dansDrosophile cellules endodermiques de l'intestin moyen. Nous avons déterminé les rôles relatifs de l'adhésion des intégrines par rapport à la signalisation dans la régulation de ces gènes cibles des intégrines. Nous constatons que l'adhésion médiée par l'intégrine n'est pas requise entre les cellules endodermiques et le mésoderme viscéral environnant pour l'expression du gène cible de l'intégrine. De plus, une protéine chimérique dépourvue de fonction d'adhésion à l'intégrine, mais qui conserve la capacité de signaler, peut se substituer à l'intégrine endogène et réguler les gènes cibles de l'intégrine. Cette chimère est constituée d'un domaine extracellulaire oligomère fusionné à l'intégrine βPS domaine cytoplasmique sous-unitaire une fusion de domaine extracellulaire monomère témoin ne modifie pas l'expression du gène cible de l'intégrine. Par conséquent, l'oligomérisation du 47-amino-acidePS domaine intracellulaire est suffisant pour initier une voie de signalisation qui régule l'expression des gènes dans l'embryon en développement.


Campbell, H., Salvi, A., O&8217Brien II, E.T., Superfine, R., & DeMali, K. (2019). “PAK2 relie la survie cellulaire à la mécanotransduction et au métabolisme.” Journal of Cell Biology 218 (6) : 1958-1971. PMC6548143

Liu, B., Hobson, C.M., Pimenta, F.M., Nelsen, E., Hsiao, J., O’Brien, E.T., Falvo, M.R., Hahn, K.M. et Superfine, R. (2019). “VIEW-MOD : un moteur d'éclairage polyvalent avec une conception optique modulaire pour la microscopie à fluorescence.” Optics Express 27(14): 19950-19972. NIHMS1053869

Marston DJ, Anderson, K.L., Swift, M.F., Rougie, M., Page, C., Hahn, K.M., Volkmann, N. et Hanein, D. (2019). L'activité élevée de Rac1 est traduite fonctionnellement en structures cytosoliques avec une architecture cytosquelettique nanométrique unique. PNAS. 116(4):1267-72. Publication en ligne du 10 janvier 2019. PMC6347697. PDF

Beicker K, O&8217Brien III, E.T., Falvo, M.R. et Superfine, R. (2018). Imagerie à vue latérale améliorée par feuille de lumière verticale pour les études de mécanique cellulaire AFM. Rapports scientifiques. 8(1504). 8(1) : 1504. PMC5784156. PDF

Carpenter J, Lynch, S.E., Cribb, J.A., Kylstra, S., Hill, D.B., & Superfine, R. (2018). Le tampon s'écoule et le mucus est transporté vers le haut dans un test de clairance du mucus incliné. American Journal of Physiology – Lung Cell Molecular Physiology. Publication en ligne du 13 septembre 2018. DOI 10.1152/ajplung.00274.2018.PMC6295511 PDF

Dagliyan O, Krokhotin, A., Ozkan-Dagliyan, I., Deiters, A., Der, C.J., Hahn, K.M, Dokholyan, N.V. (2018). Conception informatique de protéines fractionnées chimiogénétiques et optogénétiques. Communications naturelles. 9(1):4042. PMC6168510. PDF

Eicher JE, Kapustina, M., Falvo, M. et Jacobson, K. Détermination de la force de migration amiboïde 3D grâce à l'utilisation de poteaux attachés à la surface actionnés. Journal biophysique San Francisco, Californie 2018. p. 16A-7A. Résumé PDF

Judith RM, Lanham, B., Falvo, M.R., & Superfine, R. (2018). Viscosimétrie microfluidique utilisant des matrices de micropostes actionnées magnétiquement. PloS un. 13(7) : e0200345. PMC6049921 PDF

Ma X, Dagliyan, O., Hahn, K.M. et Danuser, G., (2018). Profilage de la morphodynamique cellulaire par décomposition spatio-temporelle du spectre. Biologie computationnelle PLoS. 14(8) : e1006321. Epub 2018 août doi. 10.1371/journal.pcbi.1006321. PMC6091976. PDF

Nelsen E, Hobson, C., Hsiao, J., Falvo, M., O’Brien III, ET, Watanabe, T., Hahn, K. et Superfine, R. Force Spectroscopy of Phagocytosis with High Frame Rate 3D Light Imagerie de feuille. 62e réunion annuelle de la Biophysical Society San Francisco, CA 2018. p. 530A. Résumé PDF

Shao C, Cribb, J., Osborne, L.D., O&8217Brien III, E.T., Superfine, R., Mayer-Patel, K., et Taylor II, R.M. (2018). Compression vidéo de microscopie sensible à l'analyse. Technique de recherche en microscopie. 81(7):693-703. PDF

Stefanini L, Lee, RH, Paul, DS, O’Shaughnessy, EC, Ghalloussi, D., Jones, CI, Boulaftali, Y., Poe, KO, Piatt, R., Kechele, DO, Caron, KM, Hahn, KM, Gimmins, J., M., et Bergmeier, W., (2018). Redondance fonctionnelle entre les isoformes de RAP1 dans la production et la fonction des plaquettes murines. Du sang. 132(18) : 1951-62. Publication en ligne du 21 août 2018. PMC6213319. PDF

Tarbet HJ, Dolat, L., Smith, T.J., Condon, B.M., O’Brien III, E.T., Vladivia, R.H. et Boyce, M. (2018). La glycosylation spécifique au site régule la forme et la fonction du cytosquelette à filament intermédiaire ELIFE. 7. Publication en ligne du 7 mars 2018. PMC5841932 PDF

Tajadura-Ortega, V., Garg, R., Allen, R., Owczarek, C., Bright, MD, Kean, S., Mohd-Noor, A., Grigoriadis, A., Elston, TC, Hahn, KM , Ridley, AJ (2018). Un écran ARNi des réseaux de signalisation Rho identifie RhoH comme un régulateur de Rac1 dans la migration des cellules cancéreuses de la prostate. BMC Biologie. 16(1) : 29. PMC5840776. PDF

Van Haren J, Charafeddine, R.A., Ettinger, A., Wang, H., Hahn, K.M. et Wittman, T. (2018). Contrôle local de la dynamique des microtubules intracellulaires par photo-dissociation EB1. Biologie cellulaire naturelle. 20(3) : 1504. PMC5826794. PDF

Woroniuk A, Porter, A., White, G., Newman, DT, Diamontopoulou, Z., Waring, T., Rooney, C., Strathdee, D., Marston, DJ, Hahn, KM, Sansom, oJ, Zech , T. et Malliri, A. (2018). L'activité Rac1 médiée par STEF/TIAM2 au niveau de l'enveloppe nucléaire régule la coiffe d'actine périnucléaire. Communications naturelles. 2(9):1. PMC5974301. PDF

Yan C, Wang, F., Peng, Y., Williams, CR, Jenkins, B., Wildonger, J., Kim, HJ, Perr, JB, Vaughan, JC, Kern, ME, Falvo, MR, O’Brien III, ET, Superfine, R., Tuthill, JC, Xiang, y., Rogers, SL, & Parrish, JZ (2018). L'acétylation des microtubules est requise pour la mécanosensation chez la drosophile. Rapports de cellule. 25(4):105-1065. PMC6248335 PDF

Yumerefendi H, Wang, H., Dickinson, D.J., Lerner, A.M., Malkus, P, Goldstein, B., Hahn, K. et Kuhlman, B. (2018). Le recrutement cytoplasmique dépendant de la lumière améliore la plage dynamique d'un photocommutateur d'importation nucléaire. ChemBioChem. 19(20) : 1319-1325. PMC6013380. PDF

Dagliyan O., Karginov, A.V., Yagishita, S., Gale, M.E., Wang, H., DerMardirossian, C., Wells, C.M., Dokholyan, N.V., Kasai, H. et Hahn, K.M. (2017). Commutateurs allostériques Engineering Pak1. ACS Biologie Synthétique. 6(7) :1257-62. PMC5562282. PDF

Hendrickx-Rodriguez S, Falvo, M.R., O’ Brien III, E.T. et Superfine, R. Effets de la densité et du type d'opsonine sur la phagocytose des billes. Journal biophysique 2017. p. 90A-1A. – Résumé

Herrington K.A., Trinh, A.L., Dang, C., O’Shaughnessy, E., Hahn, K.M., Gratton, E., Digman, M.A. et Sütterlin, C. (2017). L'analyse spatiale de l'activité du Cdc42 révèle un rôle du Cdc42 associé à la membrane plasmique dans la régulation des centrosomes. Biologie moléculaire de la cellule. 28(15):2135-45. PMC5509425. PDF

Markovetz MR, Seim, I., Ramsey, K., Garbarine, I.C., Forest, G.M., Schultz, A., Stick, S., Boucher, R.C. Évaluation des biomarqueurs à base de mucus de la maladie des voies respiratoires FK. Pneumologie pédiatrique 2017. p. S258. – Résumé

Takano T., Wu, M., Nakamuta, S., Naoki, H., Ishizawa, N., Namba, T., Watanabe, T., Xu, C., Hamaguchi, T., Yura, Y., Amano , M., Hahn, KM et Kaibuchi, K. (2017). Découverte de la signalisation inhibitrice à longue portée pour assurer la formation de 0,3 axone unique. Communications naturelles. 8(1):33. PMC5484694. PDF

Taylor AB, Joannou, M.S., Watanabe, T., Hahn, K. et Chew, T.L. (2017). Affichage perceptuellement précis de deux images en niveaux de gris en une seule image couleur. Journal de microscopie. 268(1):73-83. PMC5637524. PDF

Walton BL, Hehmann, M., Skorczewski, T., Holle, LA, Beckman, JD, Cribb, JA, Mooberry, MJ, Wufsus, AR, Cooley, BC, Homeister, JW, Pawlinski, R., Falvo, MR, Key, NS, Fogelson, AL, Neeves, KB et Wolberg, AS (2017). Un hématocrite élevé augmente l'accumulation de plaquettes après une lésion vasculaire. Du sang. doi:746479. PMC5418635 PDF

Woodham EF, Paul, NR, Tyrrell, B., Spence, HJ, Swaminathan, K., Scribner, MR, Giampazolias, E., Hedley, A., Clark, W., Kage, F., Marston, DJ, Hahn , KM, Tait, SW, Larue, L., Brakebusch, CH, Insall, RH et Machesky, LM (2017). Coordination par Cdc42 de l'actine, de la contractilité et de l'adhésion pour le mouvement des mélanoblastes dans la peau de souris. Biologie actuelle. 27(5) : 624-37. PMC5344686. PDF

Ye F., Yang, C., Kim, J., MacNevin, C.J., Hahn, K.M., Park, D., Ginsberg, M.H. et Kim, C. (2017). Le gallate d'épigallocatéchine a des effets pléiotropes sur la signalisation transmembranaire en modifiant l'intégration des domaines transmembranaires. Le Journal de chimie biologique. 262(24):9858-64. PMC5473239. PDF

Blackmon, R.L., Sandhu, R., Chapman, B.S., Casbas-Hernandez, P., Tracy, J.B., Troester, M.A. et Oldenburg, A.L. (2016) Imaging Extracellular Matrix Remodeling In Vitro par Diffusion-Sensitive Optical Coherence Tomography. Journal biophysique. 110(8) :1858-68. PMC4850325. PDF

Burridge K, et Guilluy, C. (2016).Adhérences focales, fibres de stress et tension mécanique. Recherche expérimentale sur les cellules. S0014-4827(15):30131-2. PMC4891215 PDF

Cribb JA, Osborne, LD, Beicker, K., Psioda, M., Chen, J., O’Brien, ET, Taylor II, RM, Vicci, L., Hsiao, JP, Shao, C., Falvo, M ., Ibrahim, JG, Wood, KC, Blobe, GC, & Superfine, R. (2016). Un Microscope à Réseau Automatique à Haut Débit Pour Cancer Cell Mechanics. Rapports scientifiques. 6:27371. PMC4893602 PDF

Dagliyan, O., Tarnawski, M., Chu, P.H., Shirvanyants, D., Schlichting, I., Dokholyan, N.V. et Hahn, K.M. (2016) Ingénierie des troubles extrinsèques pour contrôler l'activité des protéines dans les cellules vivantes. Science. 354(6318):1441-1444. PMC5362825 PDF

Evans BA, Ronecker, J.C., Han, D.T., Glass, D.R., Train, T.L. et Deatsch, Alison, E. (2016). Microsphères magnétiques en silicone fonctionnalisé à haute perméabilité à faible autofluorescence pour les applications biomédicales. Elsevier. Publication en ligne du 16 février 2016. doi:10.1016/j.msec.2016.01.094 PDF

Farzal Z, Walsh, J., Lopes de Rezende Barbosa, G., Zdanski, C.J., Davis, S.D., Superfine, R., Pimenta, L.A., Kimbell, J.S. et Drake, A.F. (2016). Analyse volumétrique de la cavité nasale chez les enfants présentant une fente labiale et palatine unilatérale et bilatérale. Laryngoscope. 126(6) : 1475-1480. PMC4752420 PDF

Gentry L.R., Karginov A.V., Hahn K.M., Der C.J. (2016) Caractérisation d'une kinase Src d'ingénierie pour étudier la signalisation et la biologie Src. Méthodes Biologie Moléculaire. 1360 : 157-167. PMC4621786. PDF

Givens, C., et Tzima, E. (2016) Mécanosignalisation endothéliale : un seul capteur convient-il à tous ? Signal redox antioxydant. 25(7) :373-388. PMC5011625 PDF

Lawrimore J, Aicher, J., Hahn, P., Fulp, A., Kompa, B., Vicci, L., Falvo, M., Taylor II, R. et Bloom, K. (2016). ChromoShake : un simulateur de dynamique chromosomique révèle que les boucles de chromatine rigidifient la chromatine centromérique. Biologie moléculaire de la cellule. 27(1):153-66. PMC4694754. PDF

MacNevin CJ, Toutchkine, A., Marston, D.J., Hsu, C-W., Tsygankov, D., Li,L., Liu, B., Qi, T., Nguyen, D-V., et Hahn, K.M. (2016). L'imagerie ratiométrique à l'aide d'un seul colorant permet la visualisation simultanée de l'activation de Rac1 et Cdc42. Journal de l'American Chemical Society. 138(8):2571-5. PMC4825053 PDF

Marjolaine RJ, Guilluy, C., et Burridge, K. (2016). Utilisation d'aimants et de billes magnétiques pour disséquer les voies de signalisation activées par la tension mécanique appliquée aux cellules. Méthodes 94:19-26. PMC4761479. PDF

Méthodes et systèmes pour utiliser des tenons actionnés attachés à la surface pour la rhéologie des biofluides, R. Superfine, R. Spero, B. Evans, B. Fiser, A. Shields, brevet américain 9 238 869 (1er février 2016)

Quammen, CW, Taylor II, RM, Krajcevski, P., Mitran, S., Enquobahrie, A., Superfine, R., Davis, B., Davis, S. et Zdanski, C. (2016) The Virtual Pediatric Établi des voies respiratoires. Études en technologie de la santé et en informatique. 220 : 295-300.PMC5588666 PDF

Scott DW, Tolbert, CE, & Burridge, K (2016). La tension sur JAM-A active RhoA via GEF-H1 et p115 RhoGEF. Biologie moléculaire de la cellule. 27(9):1420-30. PMC4850030. PDF

Spieser, DL, Gagnon, YL, Chhetri, RK, Oldenburg, AL et Johnsen, S. (2016) Examining the Effects of Chromatic Aberration, Object Distance, and Eye Shape on Image-Formation in the Mirror-Based Eyes of the Bay Pétoncle Argopecten irradians. Biologie Intégrative et Comparée. 56(5) : 796-808.PMC5886045 PDF

Wang, H., Vilela, M.,, A., Tarnawski, M., Schlichting, I., Yumerefendi, H., Kuhlman, B., Liu, R., Danuser, G. et Hahn, KM (2016) LOVTRAP : un système optogénétique pour la dissociation photo-induite des protéines. Méthodes naturelles. 13(9) :755-758. PMC5137947 PDF

Wang, H., et Hahn, K.M. (2016) LOVTRAP : Une méthode polyvalente pour contrôler la fonction des protéines avec la lumière. Protocoles actuels en biologie cellulaire. 73:21. PMC5137945. PDF

Bucay, I., O’Brien III, E.T., Wulfe, S., Superfine, R., Wolberg, A., Falvo, M. et Hudson, N. (2015). Déterminants physiques de la fibrinolyse dans les fibres de fibrine simples. PLoS One. DOI : 10.1371/journal.pone.011635. PMC4340865 PDF

Crassous JJ, Mihut, A.M., Mansson, L.K. et Schurtenberger, P. (2015). Microgels réactifs anisotropes avec forme et interactions réglables. Nanoéchelle. 7(38):15971-82. PDF

Cribb, J., Osborne, L., Hsiao, J., Vicci, L., Meshram, A., O’Brien III, ET, Spero, R., Taylor II, R. et Superfine, R. (2015 ). Microscope à matrice à haut débit pour la caractérisation mécanique des biomatériaux. Examen AIP des instruments scientifiques 86(023711). PMC4344474 PDF

Du K, Zheng, S., Zhang, Q., Li, S., Gao, X., Wang, J., Jiang, L. et Liu, K. (2015). La suppression de Pten favorise la repousse des axones du tractus corticospinal 1 an après une lésion de la moelle épinière. Le Journal des Neurosciences. 35(26):9754-63. PDF

Fiser B, Shields, A., Falvo, M. et Superfine, R. (2015). Réseaux de microactionneurs cœur-enveloppe hautement réactifs pour une utilisation dans des fluides visqueux et viscoélastiques. Journal de micromécanique et de micro-ingénierie 25(2). PMC4577244 PDF

Grube M, Cernava, T., Sho, J., Fuchs, S., Aschenbrenner, I., Lassek, C., Wegner, U., Becher, D., Riedel, K., Sensen, CW et Berg, G. (2015). Exploration des contextes fonctionnels du maintien symbiotique au sein des bactéries associées au lichen par omique comparative. La revue ISME. 9(2):412-24. PMC4303634. PMC4303634 PDF

Guilluy C, Burridge, K. (2015). Mécanotransduction nucléaire : forcer le noyau à réagir. Noyau. 6(1):19-22. PMC4615784. PMC4615784 PDF

Judith, R., Fisher, J., Spero, R., Fiser, B., Turner, A., Oberhardt, B., Taylor II, R., Falvo, M, Superfine, R. et Lab Chip (2015 ). “Micro-élastométrie sur les caillots de sang total à l'aide de tenons actionnés attachés à la surface (ASAP).” Lab Chip 15(5) : 1385-1393. PMC4545258 PDF

Lawrimore J, Vasquez, P.A., Falvo, M., Taylor II, R., Vicci, L., Yeh, E., Forest M.G. et Bloom, K. (2015). Les boucles d'ADN génèrent une tension intracentromère en mitose. Le Journal de biologie cellulaire. 210(4):553-64. PMC4539978 PDF

Li, S., He, Q., Wang, H., Tang, X., Ho, KW, Gao, X., Zhang, Q., Shen, Y., Cheung, A., Wong, F., Ip , NY, Jiang, L., Yung, WH et Liu, K. (2015). Les axones rétiniens adultes blessés avec la co-délétion Pten et Socs3 reforment les synapses actives avec les neurones suprachiasmatiques. Neurobiologie de la maladie. 73 : 366-76. PDF

Mair l, Weinberg, I., Nacev, A., Urdaneta, M., Stepanov, P., Hilaman, R., Himelfarb, S. et Superfine, R. (2015). Analyse du transport de nanotiges à travers une matrice de biopolymère. Journal du magnétisme et des matériaux magnétiques. 380:295-298 PMC4321758 PDF

Murray E, Sayyar, S., Thompson, B.C., Gorkin III, R., Officer, D.L. et Wallace, G.G. (2015). Une voie écologique et écologique vers des composites graphène/polymère traitables et biocompatibles. Avances RSC. 5(56):45284-90. PDF

Sears, P., Blackmon, R., Lynch, S., Superfine, R., Oldenburg, A. et Ostrowski, L.E. (2015) Transport mucociliaire dans des cultures circulaires de cellules épithéliales primaires des voies respiratoires humaines: effet de la fréquence des battements ciliaires et de la concentration de mucus. pulmonaire pédiatrique. 50 : 234-235. Résumé

Shao C, Zhong, A., Cribb, J., Osborne, L.D., O’Brien III, E.T., Superfine, R., Mayer-Patel, K., Taylor II, R.M. (2015). Compression vidéo en microscopie préservant l'analyse via la corrélation et la morphologie mathématique. Recherche et technique en microscopie. PMC4715596. PDF

Court B (2015). La tension monte au niveau des boucles centromériques. Le Journal de biologie cellulaire. 210(4):523. PDF

Vicory J, Couture, H.D., Thomas, N.E., Borland, D., Marron, J.S., Woosley, J. et Niethammer, M. (2015). Normalisation de l'apparence des lames d'histologie. Imagerie médicale et graphiques informatisés. 43:89-98. PMC4769595. PMC4769595 PDF

Wen B, Campbell, K.R., Cox, B.L., Eliceiri, K.W., Superfine, R. et Campagnola, P.J. Imagerie de génération de deuxième harmonique à vues multiples du tendon de la queue de souris via des micro-prismes réfléchissants. Dans : Letters O, éditeur. Juillet 2015 : Optical Society America 2015. p. 3201-4. PMC4979975 PDF

Yi JJ, Berrios, J., Newbern, J.M., Snider, W.D., Philpot, B.D., Hahn, K.M. et Zylka, M.J. (2015). Une mutation liée à l'autisme désactive le contrôle de la phosphorylation d'UBE3A. Cellule. 162(4):795-807. PMC4537845. PMC4537845 PDF

Yumerefendi H, Dickinson, D.J., Wang, H., Zimmerman, S.P., Bear, J.E., Goldstein, B., Hahn, K. et Kuhlman, B. (2015). Contrôle de l'activité des protéines et de la spécification du destin cellulaire via la translocation nucléaire à médiation lumineuse. plOs un. 10(6) :E0128443. PMC4471001. PMC4471001 PDF

Zdanski C, Davis, S., Hong, Y., Miao, D., Quammen, C., Mitran, S., Davis, B., Niethammer, M., Kimbll, J., Pitkin, E., Fine, J., Fordham, L., Vaughn, B. et Superfine, R. (2015). Évaluation quantitative des voies aériennes supérieures chez les nourrissons et les enfants atteints de sténose sous-glottique. Laryngoscope. PMC5257243 PDF

Bays J, Peng, X., Tolbert, E., Guilluy, C., Angell, A., Pany, Y., Superfine, R., Burridge, K., & Demali, A (2014). La phosphorylation de la vinculine régule de manière différentielle la mécanotransduction au niveau des adhérences cellule-cellule et cellule-matrice. Journal de biologie cellulaire. 205(2):251-63. PMC4003237. PDF

Beicker KN, O’Brien III, E.T., Falvo, M., & Superfine, R. (2014). Affichage de la déformation nucléaire avec la microscopie latérale. Société biophysique 106(2):42A-43A. (abstrait)

Bloom KS (2014). L'hétérochromatine centromérique : la machine de ségrégation primordiale. Revue annuelle de génétique. (48): 457-84. PMC4245377. PDF

Chhetri, R., K., Blackmon, R., Wu, W.-C., Hill, DB, button, B., Casbas-Hernandez, P., Troester, M., Tracy, JB et Oldenburg, AL (2014). “Étude de la nanotopologie biologique via la diffusion de nanotiges plasmoniques faiblement contraintes avec tomographie par cohérence optique.” Actes de la National Academy of Sciences 111(41): E42897-E44297. PMC4205670. PDF

Collins, C, Osborne, L., Guilluy C., Chen, Z., O’Brien III, E., Reader, J., Burridge, K., Superfine, R., & Tzima, E. (2014) Hémodynamique et les indices de la matrice extracellulaire régulent le phénotype mécanique et la rigidité des cellules endothéliales aortiques. Communications naturelles 5:3984. doi: 10.1038/ncomms4984 PMC4068264 PDF

Davidson Ward S., Amin, R., Arens, R., Chen, Z., Davis, S., Gutmark, E., Superfine, R., Wong, B., Zdanski, C. et Khoo, M. (2014). Troubles respiratoires pédiatriques liés au sommeil : avancés en imagerie et en modélisation informatique. IEEE Pulse. (Septembre/Octobre):33-9. PDF

Fisher J, & Kleckner, N. (2014). Micropiston à force magnétique : un dispositif intégré force/microfluidique pour l'application de forces de compression dans un environnement confiné. La revue des instruments scientifiques. 85(2) :023704. PMC3970836 PDF

Guilluy, C, Osborne, LD, Van Landeghem, L., Sharek, L., Superfine, R., Garcia-Mata, R. et Burridge, K. (2014) Les noyaux isolés s'adaptent à la force et révèlent une voie de mécanotransduction dans le noyau. Biologie cellulaire naturelle. 16(4):376-381. PMC4085695 PDF

Hill D, Vasques, P., Mellnik, J., McKinley, S., Vose, A., Mu, F., Henderson, A., Donaldson, S, Alexis, N., Boucher, R., & Forest, M. (2014). Une base biophysique pour la concentration de solides dans le mucus en tant que biomarqueur candidat pour les maladies des voies respiratoires. PloS un. 9(2):e87681. PMC3928107. PDF

Hong Y, Davis, B., Marron, JS, Kwitt, R., Sing, N., Kimbell, JS, Pitkin, E., Superfine, R., Davis, SD, Zdanski, CJ, & Niethammer, M. ( 2014). Construction d'atlas statistiques via des boxplots fonctionnels pondérés. Analyse d'images médicales. 18(4):684-98. PMC4029168. PDF

Hong Y, Singh, N., Kwitt, R., Vasconcelos, N. et Niethammer, M., (2014). Régression géodésique sur le Grassmannien. Actes de la Conférence européenne sur la vision par ordinateur. (Comité, 15 pages) PDF

Hong Y, Gao Y, Niethammer M, Bouix S. 2014. Analyse de forme basée sur la profondeur. Actes de la Conférence internationale sur l'informatique médicale et l'intervention assistée par ordinateur (MICCAI). (Comité, 8 pages). Prix ​​du meilleur article étudiant. PDF

Hong Y, Singh, N., Kwitt, R. et Niethammer, M. (2014). Régression géodésique déformée dans le temps. Actes de la Conférence internationale sur l'informatique médicale et l'intervention assistée par ordinateur. (Comité, 8 pages) PDF

Huang L, Hsiao, J.P., Poierza, C. Taylor II, R. et Lord, S. (2014). La topologie entraîne-t-elle la polymérisation des fibres ? Biochimie. 53(49):7824-34. PMC4270379. PDF

Lee, W., Leddy, HA, Chen, Y., Lee, SH, Zelenski, NA, McNulty, AL, Wu, J., Bieker, K., Coles, J., Zauscher, S., Sachs, J. , Guilak, F., et Liedtke, W. (2014). “La synergie entre les canaux Piezo1 et Piezo2 confère une mécanosensibilité à haute contrainte au cartilage articulaire.” Actes de la National Academy of Sciences 111(47) : E5114-E5522. PMC4250098. PDF

Lessey-Morillon, E, Osborne, L., Monaghan-Benson, E., Guilluy, C., O’Brien III, ET, Superfine, R., & Burridge, K. (2014) The RhoA GEF, LARG, médiateur Mécanotransduction dépendante d'ICAM-1 dans les cellules endothéliales pour stimuler la migration transendothéliale. Le Journal d'Immunologie. 192(7):3390-3398. PMC3991232 PDF

Mair LO, et Superfine, R. (2014). Le suivi d'une particule unique révèle un transport biphasique pendant la magnétophorèse de nanotiges à travers une matrice extracellulaire. Matière douce. 10(23):4118-25. PMC4265469 PDF

Marjoram, R.J., Lessey, E.C., & Burridge, K. (2014). Régulation de l'activité RhoA par les molécules d'adhésion et la mécanotransduction. Médecine moléculaire actuelle. 14(2):199-208. PMC3929014. PDF

Mellnik J, Vasquez, P.A., McKinley, S.A., Witten, J., Hill, D.B., Forest, M.G. (2014). Métriques de micro-hétérogénéité pour la diffusion dans la matière molle. Matière douce. 10(39):7781-96. PMC4186960. PDF

Osborne, L.D., Li, G.Z., How, T., O&8217Brien, E.T. 3e, Blobe G.C., Superfine, R. et Mythreye, K. (2014). “TGF-β régule LARG et GEF-H1 pendant l'EMT pour impacter la réponse de raidissement à la force et à l'invasion cellulaire.” Biologie moléculaire de la cellule 25(22): 3528-3540. PMC4230614. PDF

Osborne LD, Cribb, J., Vicci, L., O&8217Brien III E.T., Hsiao, J., Taylor, R.M. II, & Superfine, R. (2014). Microscope à Réseau Pour La Caractérisation De La Rigidité À Haut Débit Du Cancer Biology. Société biophysique 106(2):619A-619A. (abstrait)

Shan L, Zach, C., Charles, C. et Niethammer, M., (2014). Segmentation automatique du cartilage à trois étiquettes basée sur Atlas à partir d'images MR Knee. Analyse d'images médicales. 18 (7) : 1233-46. PDF

Sing N, Couture, H.D., Marron, J.S., Peru, C., & Niethammer, M. Topological Descriptors of Histology Images. Apprentissage automatique en imagerie médicale : Springer International Publishing 2014. p. 231-239. Chapitre du livre. PDF

Sing N, et Niethammer, M., (2014). Splines pour la régression d'images difféomorphes. Actes de la Conférence internationale sur l'informatique médicale et l'intervention assistée par ordinateur. 17 : 121-9. PDF

Taylor II R, Shao, C., Zhong, A., et Mayer-Patel, K., inventeur MÉTHODES, SYSTÈMES ET SUPPORTS LISIBLES PAR ORDINATEUR POUR COMPRESSER LES IMAGES VIDÉO. Demande de brevet provisoire aux États-Unis 2014.

Taylor II R, et Harter, J., (2014). Modulation de luminance aléatoire par élément pour un suivi visuel amélioré. Infographie et applications IEEE. 34(6):83-87. PDF

Thompson M, Tolbert, C., Shen, K., Kota, P., Palmer, S., Plevock, K., Orlova, A., Galkin, V., Burridge, K., Egelman, E., Dokholyan, N., Superfine, R., & Campbell, S. (2014). Identification d'une surface de liaison à l'actine sur la vinculine qui médie les propriétés mécaniques des cellules et de l'adhérence focale. Structure. 22(5) :697-706. PMC4039106 PDF

Tolbert CE, Thompson, P.M., Superfine, R., Burridge, K., Campbell, S.L. (2014). Phosphorylation à Y1065 Dans Vinculine Médiat Actine Regroupement, Propagation Cellulaire, Et Réponses Mécaniques à Forcer Biochemistry. 53(34):5526-36. PMC4151700. PDF

Waldon, S., Thompson, P., Hahn, P., Taylor II, R. (2014). “SketchBio : Interface 3D d'un scientifique pour la modélisation et l'animation moléculaires.” BMC Bioinformatics Journal 15 (334). PMC4287593 PDF

Wijesundara K, Zdanski, C., Kimbell, J., Price, H., Iftimia, N. et Oldenburg, A.L. (2014). Endoscopie quantitative des voies aériennes supérieures avec tomographie par cohérence optique anatomique à source balayée. Optique Biomédicale Express. 5(3):788-799. PMC3959831. PDF

Zhao Q, Pizer, S., Niethammer, M. et Rsoenman, I., (2014). Correspondance de graphe spectrale basée sur des caractéristiques géométriques dans l'enregistrement de la surface pharyngée. Actes de la Conférence internationale sur l'informatique médicale et l'intervention assistée par ordinateur. (Comité, 8 pages). PMC4382356 PDF

Noter: La communauté informatique utilise les actes de conférence comme principal mode de diffusion, avec des taux d'acceptation souvent inférieurs à 30 %. Ils ont donc le statut d'articles de revues à comité de lecture.

Nouveau TRD2. Références des outils d'imagerie biomoléculaire : Nous rapportons les références récentes du TRD PI Prof. Klaus Hahn. Ce travail a ne pas été soutenu par le CISMM au cours de l'année écoulée, mais nous en rendons compte ici pour faciliter l'accès et les informations sur les opportunités de collaboration.

Helassa N, Garnett JP, Farrant M, Khan F, Pickup JC, Hahn KM, MacNevin CJ, Tarran R, Baines DL. Une nouvelle protéine de capteur fluorescente pour détecter les changements dans la concentration de glucose liquide à la surface des voies respiratoires. Biochem J. 15 septembre 2014. [Publication électronique avant impression] PMID : 25220254

Weitzman M, Hahn KM. Approches optogénétiques de la migration cellulaire et au-delà. Curr Opin Cell Biol. 2014 octobre 30C:112-120. doi: 10.1016/ Publication en ligne du 15 septembre 2014. PMID : 25216352

Chu PH, Tsygankov D, Berginski ME, Dagliyan O, Gomez SM, Elston TC, Karginov AV, Hahn KM. L'activation de la kinase d'ingénierie révèle des phénotypes morphodynamiques uniques et le trafic associé pour les isoformes de la famille Src. Proc Natl Acad Sci U S A. 2014 août 26111 (34): 12420-5. doi: 10.1073/pnas.1404487111. PMID : 25118278 [PubMed – en cours]

Tsygankov D, Chu PH, Chen H, Elston TC, Hahn KM. Des outils conviviaux pour quantifier la dynamique de la morphologie cellulaire et des clusters de protéines intracellulaires. Méthodes Cell Biol. 2014123 : 409-27. doi: 10.1016/B978-0-12-420138-5.00022-7. PMID : 24974040 [PubMed – en cours]

Yi JJ, Wang H, Vilela M, Danuser G, Hahn KM Manipulation de l'activité kinase endogène dans les cellules vivantes à l'aide de peptides inhibiteurs photocommutables. ACS Synth Biol. 13 juin 2014. PMID : 24905630

Karginov AV, Hahn KM, Deiters A.Activation optochimique de la fonction kinase dans les cellules vivantes.Méthodes Mol Biol. 20141148 : 31-43. doi: 10.1007/978-1-4939-0470-9_3. PMID : 24718793

Disséquer la signalisation de la motilité par l'activation de complexes effecteurs Src spécifiques. Nat Chem Biol. 10 avril 2014 (4) : 286-90. doi: 10.1038/nchembio.1477. Publication en ligne du 9 mars 2014. Erratum dans : Nat Chem Biol. 10 août 2014 (8) : 692. PMID : 24609359

Hinde E, Yokomori K, Gaus K, Hahn KM, Gratton E. Imagerie basée sur les fluctuations de l'activation nucléaire de Rac1 par oligomérisation de protéines. Sci Rep. 2014 février 274:4219. doi: 10.1038/srep04219. PMID : 24573109

Tsygankov D, Bilancia CG, Vitriol EA, Hahn KM, Peifer M, Elston TC. CellGeo : une plate-forme de calcul pour l'analyse des changements de forme dans des cellules à géométries complexes. J Cell Biol. 2014 février 3204(3):443-60. doi: 10.1083/jcb.201306067. PMID : 24493591

Morrow PK, Broxson AC, Munsell MF, Basen-Enquist K, Rosenblum CK, Schover LR, Nguyen LH, Hsu L, Castillo L, Hahn KM, Litton JK, Kwiatkowski DN, Hortobagyi GN. Effet de l'âge et de la race sur la qualité de vie des jeunes survivantes du cancer du sein. Cancer du sein Clin. 14 avril 2014 (2) : e21-31. doi: 10.1016/j.clbc.2013.10.003. Publication en ligne du 25 octobre 2013. PMID : 24461458

Khalil BD, Hanna S, Saykali BA, El-Sitt S, Nasrallah A, Marston D, El-Sabban M, Hahn KM, Symons M, El-Sibai M La régulation de RhoA aux adhérences focales par StarD13 est importante pour la motilité des cellules de l'astrocytome . Exp Cell Res. 2014 février 15321(2):109-22. doi: 10.1016/j.yexcr.2013.11.023. Publication en ligne du 10 décembre 2013. PMID : 24333506

Cai D, Chen SC, Prasad M, He L, Wang X, Choesmel-Cadamuro V, Sawyer JK, Danuser G, Montell DJ. La rétroaction mécanique via l'E-cadhérine favorise la détection de la direction pendant la migration cellulaire collective. Cellule. 2014 mai 22157(5):1146-59. doi : 10.1016/j.cell.2014.03.045. PMID : 24855950

Martin K, Vilela M, Jeon NL, Danuser G, Pertz O. Un module cytosquelettique à organisation spatiale induit par un facteur de croissance permet une migration rapide et persistante des fibroblastes. Cellule de développement. 29 septembre 2014 (6) : 701-16. doi: 10.1016/j.devcel.2014.07.022. IDPM : 25268172

Burridge K, & Wittchen, E. (2013). La tension monte : Les fibres de contrainte en tant que mécanotransducteurs générateurs de force. Journal de biologie cellulaire. 200(1):9-19. PMC3542796. PDF

Calloway, H., Kimbell, J., Davis, S., Retsch-Bogart, G., Pitkin, E., Abode, K., & Superfine, R. (2013). Comparaison des mesures endoscopiques par rapport aux mesures des voies aériennes dérivées de la tomodensitométrie 3D. Laryngoscope.123(9) :2136-2141 PDF

Cao, T., Jojic, V., Modla, S., Powell, D., Czymmek, K., & Niethammer, M. (2013). Apprentissage de dictionnaire multimodal robuste. . Société d'Imagerie Médicale et d'Intervention Assistée par Ordinateur. Chapitre du livre PDF

Cao T, Zach, C., Modla, S., Powell, D., Czymmek, K. et Niethammer, M. (2014). Recalage multimodal pour la microscopie corrélative à l'aide d'analogies d'images. Analyse d'images médicales. 18(6):914-26. PMC4062605. PDF

Collins, C., & ampTzima, E. (2013). RhoA devient MONDIAL. Petit GTPases.4(2):123-126. PMC3747253 PDF

Cribb, J., Vasquez, P., Moore, P., Norris, S., Shah, S., Forest, M., Superfine, R. (2013). Signatures non linéaires dans la rhéologie des microbilles actives de solutions de polymères enchevêtrés. Journal of Rheology.57(4):1247-1264. PMC3920902 PMC3920902/PDF

Csapo, I, Davis, B., Shi, Y., Sanchez, M., Styner, M., Niethammer, M. (2013) Recalage d'image longitudinale avec mesure de similarité d'image dépendante du temps. Transactions IEEE sur l'imagerie médicale. 32(10) : 1939-1951. PMC3947578 PMC3947578 /PDF


Fisher J, Bourniguel, A., Witz, G., Weiner, B., Prentiss, M., & Kleckner, N. (2013). Imagerie à quatre dimensions de l'organisation et de la dynamique des nucléoïdes d'E. coli dans les cellules vivantes. Cellule. 153(4):882-95. PMC3670778 PDF

Funkhouser 3rd, K. W., Niethammer, M., Carson, J., Burns, K., Knowles, M., Leigh, M., Zariwala, M., & Funkhouser Jr, W.K. (2013). Un nouvel outil améliore les performances des tests de diagnostic pour l'évaluation EM de la transmission des bras axonémal en dynéine. Pathologie ultrastructurale. PMC3990650 PDF

Haase, J., Mishra, P., Stephens, A., Haggerty, R., Quammen, C., Taylor II, R., Yeh, E., Basrai, M., & Bloom, K., (2013) Une carte 3D du kinétochore de levure révèle la présence d'histones spécifiques au centre et aux centromères accessoires. Biologie actuelle. 23(19):1936-1944. PMC3796065 PDF

Hanna, S., , Krishnan, B., Bailey, S., Moschos, S., Kuan, P., Shimamura, T., Osborne, L., Siegel, M., Duncan, L., O’Brien III , E., Superfine, R., Miller, C., Simon, M., Wong. K., et Kim, W. (2013). HIF1α et HIF2α activent indépendamment le SRC pour favoriser les métastases du mélanome. Journal d'investigation clinique. 123(5):2978-2093. PMC3635738 PMC3635738/PDF

Herschlaq, G., Garcia, G.J., Button, B., Tarran, R., Lindley, B., Reingardt, B., Elston, T.C., & Forest, G.M. (2013). Un modèle mécanochimique pour l'autorégulation du volume de la couche superficielle des voies respiratoires pulmonaires. Journal de biologie théorique. (325)42-51. PMC3631568 PDF

Hong, Y., Davis, B., Marron, J., Kwitt, R. et Niethammer, M. (2013). Boxplot fonctionnel pondéré avec application à la construction d'atlas statistiques. Société d'Imagerie Médicale et d'Intervention Assistée par Ordinateur. 16 (Pt 3) : 584-591. Chapitre du livre PDF

Hong, Y., Niethammer, M., Andruejol, J., Kimbell, J., Pitkin, E., Superfine, R., Davis, S., Zdanski, C. et Davis, B. (2013). Un atlas pédiatrique des voies respiratoires et son application dans la sténose sous-glottique. Symposium international sur l'imagerie biomédicale : du nano au macro. PDF

Horowitz, E., Rahman, S., Bower, B., Dismuke, D., Falvo, M., Griffith, J., Harvey, S. et Asokan, A. (2013). Caractérisation biophysique et ultrastructurale du décapage de la capside virale adéno-associée et de la libération du génome. Journal of Virology.87(6):2994-3002. PMC3592113 PMC3592113/PDF

Hudson, N., Ding, F., Bucay, I., O’Brien III, ET, Gorkun, O., Superfine, R., Lord, S., Dokholyan, N., & Falvo, M. (2013) . Le recul élastique inférieur à la milliseconde révèle les origines moléculaires de la mécanique des fibres de fibrine. Journal biophysique. 104(12):2671-2680. PMC3686331 PDF

Jones, G, Blonder, R., Gardner, G., Alve, V., Falvo, M., & Chevrier, J. (2013) Nanotechnology and nanoscale science: Challenges éduquer la prochaine génération. Journal international de l'enseignement des sciences. en ligne. “Non pris en charge par le NIH”

Kohli L, Whitton, M. et Brooks, F. (2013). Toucher redirigé : entraînement et adaptation à l'espace virtuel déformé. Actes du Symposium IEEE 2013 sur les interfaces utilisateur 3D 3DUI.79-86. PDF

Mitran, S. (2013). Modèle continuum-cinétique-microscopique de la clairance pulmonaire due à l'entraînement du fluide noyau-annulaire. Journal de physique computationnelle. (244):193-211.PMC3665523 PDF

Niethammer, M., et Zach, C. (2013). Segmentation avec contraintes de zone. Analyse d'images médicales.17(1):101-112. PMC3656501 PMC3656501/PDF

Oldenburg, A., Chhetri, R., Cooper, J., Wu, W., Troeste, M., & Tracy, J. (2013) La tomographie par cohérence optique sensible à la motilité, à l'autocorrélation et à la polarisation discrimine les cellules et l'or nanotiges dans les cultures tissulaires 3D. Lettres d'optique. 38(15):2923-2926. PMC3856705 PDF

Qian, X., Song, J.M., Melkamu, T., Upadhyaya, P., & Kassie, F. (2013) Chimioprévention de la tumorigenèse pulmonaire par du diindolylméthane administré par voie intranasale chez des souris A/J. Carcinogenèse. 34(4):841-849. PMC3616664 PDF

Samson T, van Buul, J., Droon, J., Welch, C., Bakker, E., Matlung, H., van den Berg, T., Sharek, L., Doerschuk, C., Hahn, K. , & Burridge, K. (2013). Le facteur d'échange guanine-nucléotide SGEF joue un rôle crucial dans la formation de l'athérosclérose. PloS un. 8(1):55202. PMC3555862. PDF

Stephens, A., Haggerty, R., Vasquez, P., Vicci, L., Snider, C., Shih, F., Quammen, C., Mullins, C., Haase, J., Taylor II, R. , Verdaasdonk, J., Falvo, M., Jin, Y. Forest, G., & Bloom, K. (2013). Les boucles de chromatine péricentriques fonctionnent comme un ressort non linéaire dans l'équilibre de la force mitotique. Journal of Cell Biology.200(6):757-772. PMC3601350 PMC3601350/PDF

Stephens A, Snider, C., Haase, J., Haggerty, R., Vasquez, P., Forest, M., & Bloom, K. (2013). Les péricentromères individuels présentent un mouvement et un étirement coordonnés dans le fuseau de levure. Journal de biologie cellulaire. 203(3):407-16. PMC3824013 PDF

Stephens A, Quammen, C., Chang, B., Haase, J., Taylor, R., & Bloom, K. (2013). La ségrégation spatiale de la cohésine et de la condensine péricentriques dans le fuseau mitotique. Biologie moléculaire de la cellule. 24(24):3909-19. PMC3861086 PDF

Tolbert C, Burridge, K., & Campbelle, S. (2013). Régulation par la vinculine de la formation de faisceaux d'actine F : qu'est-ce que cela signifie pour la cellule ? Adhésion cellulaire et migration. 7(2):219-25. PMC3954036. PDF

Tretter, T., Jones, M., & Falvo, M. (2013). Nanosciences pour tous : stratégies d'enseignement des nanosciences aux étudiants de premier cycle en sciences et aux majeures non scientifiques. Journal of Nano Education.5 (1):1-9. “Non pris en charge par le NIH’

Varshney, RK, Song, C., Saxena, RK, Azam, S., Yu, S., Sharpe, AG, Cannon, S., Baek, J., Rosen, BD, Tar’an, B., Millan, T., Zhang, X., Ramsay, LD, Iwata, A., Wang, Y., Nelson, W., Farmer, AD, Gaur, PM, Soderlund, C., Penmetsa, RV, Xu, C., Bharti , AK, He, W., Winter, P., Zhao, S., Hane, JK, Carrasquilla-Garcia, N., Condie, JA, Upadhyaya, HD, Luo, MC, Thudi, M., Gowda, CL, Singh, NP, Lichtenzveig, J., Gali, KK, Rubino, J., Nadarajan, N., Dolezel, J., Bansal, KC, Xu, X., Edwards, D., Zhang, G., Kahl, G ., Gil, J., Sing, KB, Datta, SK, Jackson, SA, Wang, J., & Cook, DR (2013) Le projet de séquence du génome du pois chiche (Cicer arietinum) fournit une ressource pour l'amélioration des caractères. Biotechnologie nationale. 31(3):240-246. PDF

Vasquez, P., Jin, Y., Yuong, K., Hill, D.B., & Forest, G. (2013). Une nouvelle tournure du deuxième problème de Stokes : la pénétration partielle de la non-linéarité dans les couches viscoélastiques cisaillées. Journal of Non-Newtonian Fluid Mechanics.196(0):36-50. PDF

Verdaasdonk J, Vasquez, P., Barry, R., Barry, T., Goodwin, S., Forest, M., & Bloom, K. (2013). L'attache du centromère confine les domaines chromosomiques. Cellule moléculaire. 52(6):819-31. PMC3877211 PDF

Verdaasdonk J, Stephens, A., Haase, J. et Bloom K. (2013). Inverser Les Règles: La Microscopie à Champ Large Et La Limite Abbe De Résolution Journal of Cellular Physiology. 229(2):132-8. PMC4076117. PDF

Wijesundara, K., Iftimia, N., & Oldenburg, A. (2013). Conception d'un système OCT anatomique à source balayée pour la bronchoscopie pédiatrique. Actes de SPIE. 8571. doi : 10.1117/12.2004226. PMC3864962 PDF

Alabi, O., Wu, X., Harter, J., Phadke, M., Pinto L., Petersen, H. Bass, S., Keifer, M., Zhong, S., Healey, C. et Taylor II, R. Visualisation comparative d'ensembles à l'aide du découpage de surface d'ensemble. Actes de SPIE Visualization and Data Analysis 2012 Janvier 2012 Burlingame, California.8294:82940U. PMC3614370 PMC3614370/PDF

Button, B., Cai, L.H., Ehre, C., Kesimer, M., Hill, D.B., Sheehan, J., Boucher, R. et Rubinstein, M. (2012). Une brosse périciliaire favorise la santé pulmonaire en séparant la couche de mucus de l'épithélium des voies respiratoires. Science.337(6097):937-941. PMC3633213 PMC3633213/PDF

Camassa, R., Forest, M.G., Lee, L., Ogrosky, H.R., Olander, J. (2012). Ondes annulaires comme mécanisme de transport de masse dans les écoulements noyau-annulaires entraînés par l'air. Examen physique. E, Physique statistique, non linéaire et de la matière molle. 86 (6 pt 2) PDF

Cao, T., Zach, C., Modla, S., Powell, D., Czymmek, K. et Niethammer, M. (2012). Inscription pour la microscopie corrélative à l'aide d'analogies d'images. Enregistrement d'images biomédicales (WBIR).7359:296-306 NIHMS596525 PDF

Chhetri, R., Phillips, Z., Torester, M., & Oldenburg, A. (2012) L'étude longitudinale des co-cultures épithéliales et fibroblastiques mammaires à l'aide de la tomographie par cohérence optique révèle les caractéristiques morphologiques de la pré-malignité. PLoS One. 7(11):e49148. PMC3495770 PMC3495770/PDF

Collins, C., Guilluy, C., Welch, C., O’Brien, T., Hahn, K., Superfine, R., Burridge, K. et Tzima, E. (2012). Des forces de tension localisées sur PECAM-1 provoquent une réponse globale de mécanotransduction via la voie intégrine-RhoA. Biologie actuelle.22(22):2087-2094. PMC3681294 PDF

Csapo, I., Davis, B., Shi, Y., Sanchez, M., Styner, M., Niethammer, M. (2012). Enregistrement d'image longitudinale avec changement d'apparence non uniforme. Imagerie Médicale et Intervention Assistée par Ordinateur (MICCAI). 15 (Pt 3) : 280-288. PMC3584325 PMC3584325/PDF

Didier G, McKinley, S., Hill, D.B., & Fricks, J. (2012). Défis statistiques en microrhéologie. Journal d'analyse des séries chronologiques. 33(5) : 724-43. PDF

Evans, B., Fiser, B., Prins, W., Rapp, D., Shields, A., Glass, D. et Superfine, R. (2012). Un élastomère magnétique à base de silicone hautement ajustable avec une homogénéité à l'échelle nanométrique. Journal of Magnetism and Magnetic Materials.324(4):501-507. PMC3241051 PMC3241051/PDF

Grooman, B., Fujiwara, I., Otey, C., Upadhyaya, A. (2012) Morphologie et viscoélasticité des réseaux d'actine formés avec les agents de réticulation interagissant mutuellement : palladine et alpha-actinine. PLoS One. 7(8) :e42773. PMC3420904 PMC3420904/PDF

Haase, J., Stephens, A., Verdaasdonk, J., Yeh, E. et Bloom, K. (2012). Bub1 Kinase et Sgo1 modulent la chromatine péricentrique en réponse à l'altération de la dynamique des microtubules. Biologie actuelle.22(6):471-481.PMC3311747 PMC3311747/PDF

Harter J, Wu, X., Alabi, O., Phadke, M., Pinto, L., Dougherty, D., Petersen, H., Bass, S., & Taylor II, R. Augmenter la visibilité perceptuelle des relations dans les tracés de coordonnées parallèles. Actes de SPIE Visualization and Data Analysis Janvier 2012 Burlingame, California.8294:T1 – T12.PMC3491905 PMC3491905/PDF

Hong, Y., Joshi, S., Sanchez, M., Styner, M., Niethammer, M. (2012). Régression géodésique métamorphique. Imagerie médicale informatique et intervention assistée par ordinateur (MICCAI).15 (Pt 3) : 197-205. PMC3584322 PMC3584322/PDF

Hong, Y., Shi, Y., Styner, M., Sanchez, M. et Niethammer, M. (2012). Régression géodésique simple pour les séries temporelles d'images. Enregistrement d'images biomédicales (WBIR). 7359:11-20. NIHMS596520 PDF

Jerald J, Whitton, M. et Brooks, F. (2012). Seuils de mouvement de scène pendant le lacet de la tête pour les environnements virtuels immersifs. Transactions ACM sur la perception appliquée. 9(1). PMC4334481 PDF

Kallemov, B., Miller, G.H., Mitran, S. et Trebotich, D. (2012). Calcul du flux viscoélastique tringle-bille médié par une échelle cinétique homogénéisée avec contraintes holonomiques. Simulation moléculaire.38(10) :786-792

Kesimer, M., Ehre, C., Burns, K.A., Davis C.W., Sheehan, J.K., Pickles, R.J. (2012). Organisation moléculaire des mucines et du glycocalyx sous-jacents au transport du mucus sur les surfaces muqueuses des voies respiratoires. Mucosal Immunology.6(2):379-392. PMC3637662 PMC3637662/PDF

Kohli L, Whitton, M. et Brooks, F. (2012). Toucher redirigé : effet de la déformation de l'espace sur les performances de la tâche. Interfaces utilisateur 3D (3DUI), IEEE Xplore Digital Library.105-12. PDF

Lam Hui, K., Wang, C., Grooman, B., Wayt, J., & Upadhyaya, A. (2012) La dynamique membranaire est en corrélation avec la formation de clusters de signalisation lors de la propagation cellulaire. Revue de biophysique. 102 (7) : 1524-1533. PMC 3318117 PMC3318117/PDF

Lee, H., Foskey, M., Niethammer, M., Krajcevski, P., & Lin, M. (2012). Estimation articulaire basée sur la simulation des paramètres de déformation corporelle et d'élasticité pour l'analyse d'images médicales. Transactions IEEE sur l'imagerie médicale. 31(11):2156-2168. NIHMS555789 PDF

Lessey, E., Guilluy, C. et Burridge, K. (2012). De la force mécanique à l'activation de RhoA. Biochimie.51(38):7420-7432.PMC3567302 PMC3567302/PDF

Lewek, M., Feasel, J., Wentz, E., Brooks Jr, F. et Whitton, M. (2012). Utilisation du feedback visuel et proprioceptif pour améliorer la vitesse de marche et la symétrie spatio-temporelle après un AVC chronique : une série de cas. Physiothérapie.92 (5) : 748-756. PMC3345339 PMC3345339/PDF

Lindley, B., Forest, M.G., Smith, B., Mitran, S. et Hill, D. (2012). Distributions spatiales des contraintes et des déformations des couches viscoélastiques en cisaillement oscillatoire. Mathématiques et informatique en simulation.82(7):1249-1257.PMC3338131 PMC3338131/PDF

Liu, C., Miller, H., Orlowski, G., Hang, H., Upadhyaya, A., & Song, W. (2012) La réorganisation de l'actine est requise pour la formation de signalosomes polarisés des récepteurs des cellules B en réponse aux deux antigènes solubles et membranaires. Journal d'immunologie. 188 (7) : 3237-3246. PMC3312033 PMC3312033/PDF

Liu, C., Miller, H., Sharma, S., Beaven, A., Upadhyaya, A., & Song, W. (2012) Analyse de la dynamique de l'actine lors de l'activation du récepteur des cellules B dans les cellules B vivantes. Communications de recherche biochimique et biophysique. 427(1):202-206. PMC3499104 PMC3499104/PDF

Miedema, J., Marron, J. S., Niethammer, M., Boland, D., Woosley, J., Coposky, J., Wei, S., Reisner, H. et Thomas, N. E. (2012). Image et analyse statistique de l'histologie mélanocytaire. Histopathologie.61(3):436-444.PMC3425719 PMC3425719/PDF

Oldenburg, A., Chhetri, R., Hill, D.B., & Button, B. (2012). Surveillance du flux de mucus des voies aériennes et de l'activité ciliaire par tomographie par cohérence optique.3(9) :1978-1992.PMC3447542 PMC3447542/PDF

Peck T, Fuchs, H et Whitton, M. (2012). La conception et l'évaluation d'une interface de locomotion réelle à grande échelle. Transactions IEEE sur la visualisation et l'infographie. 18(7) : 1053-67. PMC4091684 PDF

Park, R., Ping, L., Song, J., Hong, S.Y., Choi, T.Y., Choi, J.R., Gorkun, O.V. et Lord, S.T. (2012). Le résidu de fibrinogène γAla341 est nécessaire pour la liaison du calcium et les interactions ‘A-a’. Journal of Thrombosis and Haemostasis.107(5):875-883

Phadke, M., Pinto, L., Alabi, F., Harter, J., Taylor II, R., Wu, X., Petersen, H., Bass, S. et Healey, C. Exploring Ensemble Visualization. Actes de SPIE Visualization and Data Analysis 2012 Janvier 2012 Burlingame, California.8294 : (82940B). PMC3278305 PMC3278305/PDF

Roh-Johnson, M., Shemer, G., Higgins, CD, McClellan, JH, Werts, AD, Tulu, États-Unis, Gao, L., Betzig, E., Kiehart, DP et Goldstein, B. (2012) .Déclenchement d'un changement de forme cellulaire en exploitant les contractions d'actomyosine préexistantes. Science.335(6073):1232-1235.PMC3298882 PMC3298882

Taylor II, R., et Bloom, K. ?Intersecter l'art et l'infographie ? dans Visual Strategies de Felice Frankel et Angela H. DePace : ISBN 978-0-300-17644 2012. p. 102-107. Chapitre du livre

Cai, L.H., Panyukov, S. et Rubinstein, M. (2011) Mobility of Nonsticky Nanoparticles in Polymer Liquids. Macromolécules. 44(19):7853-7863 PDF

Caplan, J., Niethammer, M., Taylor II R. et Czymmek, K. (2011). La puissance de la microscopie corrélative : multimodale, multi-échelle, multidimensionnelle. Opinion actuelle en biologie structurale.21 (5): 686-693. PMC3189301 PMC3189301/PDF

Eastwood, B., Mair, L. et Taylor II, R. (2011). Une méthode d'illumination structurée pour le suivi de scène au microscope. Conférence internationale sur le traitement d'images, la vision par ordinateur et la reconnaissance de formes. 1:201-207. NIHMS325150 « non excepté par PMC » PDF

Evans B., Superfin R. (2011). Considérations de conception pour les cils actionnés magnétiquement. Applications basées sur le biomimétisme (p. 473-498). Anne George (éd.), Rijeka, Croatie : InTech. Chapitre du livre PDF

Feasel, J., Whitton, M., Kassler, L., Brooks, F. et Lewek, M. Le système de tapis roulant de réhabilitation d'environnement virtuel intégré. Transactions IEEE sur les systèmes neuronaux et l'ingénierie de la réhabilitation 2011.19 (3) : 290-297. PDF

Finan, J.D., Leddy, H.A., & Guilak, F. (2011) Le stress osmotique modifie la condensation de la chromatine et le transport nucléocytoplasmique. Communications de recherche biochimique et biophysique. 408(2):230-235. PMC3104296 PMC3104296/PDF

Fronczek, D., Quammen, C., Wang, H., Kisker, C., Superfine, R., Taylor II, R., Erie, D., Tessmer, I. (2011). Imagerie hybride Fiona-AFM de haute précision. Ultramicroscopie.111(5):350-355. PMC3179268 PMC3179268/PDF

Gibbs-Flournoy, E., Bromberg, P., Hofer, T., Samet, J., & Zucker, R. (2011) Détection par microscopie à fond noir-confocal de l'internalisation de particules à l'échelle nanométrique par des cellules pulmonaires humaines. Toxicologie des particules et des fibres. 8:2. PMC3033333 PMC3033333/PDF

Guilluy C., Swaminathan, V., Garcia-Mata R., O’Brien, E., Superfine, R., Burridge K. (2011). Les Rho GEF LARG et GEF-H1 régulent la réponse mécanique à la force sur les intégrines. Biologie cellulaire naturelle. 13 juin 2011(6) : 724-729. PMC3107386 PMC3107386/PDF

Guilluy, C., Garcia,-Mata, R., & Burridge, K. (2011) Rho protein crosstalk : un autre réseau social ? Tendances en biologie cellulaire. 21(12):718-726. PMC3221770 PMC3221770/PDF

Lewis, J., Hembree, W., Furman, B., Tippets, L., Cattel, D., Huebner, J., Little, D., & DeFrate, L. (2011) La pathologie articulaire aiguë et l'inflammation synoviale sont associée à une sévérité accrue des fractures intra-articulaires du genou de la souris. Arthrose et cartilage. 19(7):864-873. PMC3312469 PMC3312469/PDF

Liu, C., Miller, H., Hui, KL, Grooman, B., Bolland, S., Upadhyaya, A., & Song, W. (2011) Un équilibre entre la tyrosine kinase de Bruton et l'activation de SHIP régule B formation de clusters de récepteurs cellulaires en contrôlant le remodelage de l'actine. Journal d'immunologie. 187(1):230-239. PMC3119787 PMC3119787/PDF

Lozoya O., Wauthier E., Turner R., Barbier C., Prestwich G., Guilak F., Superfine R., Lubkin S., Reid L. Régulation du phénotype de la tige/progéniteur hépatique par la rigidité du microenvironnement dans les modèles hydrogels Niche de cellules souches du foie humain. Biomatériaux. 32(30):7389-7402. PMC3157321. PMC3157321/PDF

Mair, L. O., Evans, B., Hall, A. R., Carpenter, J., Shields, A., Ford, K., Millard, M., & Superfine, R. (2011). Natation proche de la surface hautement contrôlable des nanotiges Janus magnétiques : application à la capture et à la manipulation de la charge utile. Journal of Physics D : Physique appliquée. 44(125001). NIHMS337284 PDF

Merkel, T., Jones, S., Herlihy, K., Kersey, F., Shields, A., Napier, M., Luft, J., Wu, H., Zamboni, W., Wang, A., Bear, J., & DeSimone, J. (2011). Utilisation du mimétisme mécanobiologique des globules rouges pour prolonger les temps de circulation des microparticules d'hydrogel. Actes de l'Académie nationale des sciences.108(2):586-591. PMC3021010 PMC3021010/PDF

Mitran, S., & Young, J. (2011). Calcul à plusieurs échelles de la mécanique du cytosquelette pendant le blebbing. Mécanique cellulaire et biomoléculaire et mécanobiologie.345-371 PDF

Niethammer, M., Hart, G., Pace, D., Vespa, P., Irimia, A., Van Horn, J. et Aylward, S. Métamorphose géométrique. Conférence sur l'informatique médicale et l'intervention assistée par ordinateur 2011.14:639-646. PMID21995083 PDF

Niethammer, M., Huang, Y., Vialard, F., (2011) Geodesic Regression for Image Time-Series, Conference on Medical Image Computing and Computer Assisted Intervention (MICCAI). 14(Pt 2) : 655-662. PMID21995085 PDF

Pace, D., Enquobahrie, A., Yang, H., Aylward, S. et Niethammer, M. Enregistrement d'images déformables des organes coulissants à l'aide de la régularisation diffuse anisotrope. Le Symposium international sur l'imagerie biomédicale 2011:407-413.PMC3141338 PMC3141338/PDF

Peck, T., Fuchs, H., & Whitton, M. Une évaluation de la capacité de navigation comparant l'exploration libre redirigée avec des distracteurs aux interfaces de marche sur place et de locomotion par joystick. Actes de la réalité virtuelle IEEE du 19 au 23 mars 2011 Singapour : 55-62.PMC3268068 PMC3268068/PDF

Ping, L. Huang, L., Cardinali, B., Profumo, A., Gorkun, OV, & Lord, ST, (2011) La substitution de la région aC humaine par le domaine analogue du poulet génère un fibrinogène avec une agrégation latérale gravement altérée : Les monomères de fibrine s'assemblent en protofibrilles mais les protofibrilles ne s'assemblent pas en fibres. Biochimie. 50(42(:9066-9075. PMC3203410 PMC3203410

Quammen, C. et Taylor II, R. (2011). Voxelisation de grille avec effets de volume partiel en VTK. Journal VTK. Mars. NIHMS325155 “non excepté par PMC” PDF

Shen, K., Tolbert, C.E., Guilluy, C., Swaminathan, V.S., Berginski, M.E., Burridge, K., Superfine, R. et Campbell, S.L. (2011). L'épingle à cheveux C-terminale de vinculine médie la formation de faisceaux d'actine F, l'adhésion focale et les propriétés mécaniques cellulaires. Journal de chimie biologique. 286(52):45103-45115. PMC3247952 PMC3247952/PDF

Skarbez, R., Kotranza, A., Brooks, F., Lok, B. et Whitton, M. Une exploration initiale des erreurs conversationnelles en tant que nouvelle méthode d'évaluation des expériences humaines virtuelles. Actes de l'IEEE Virtual Reality 2011 Mars 2011 Singapour : 243-244 PDF

Spero, R., Sircar, R., Shubert, R., Taylor II, R., Wolberg, A., Superfine, R. (2011). La diffusion de nanoparticules mesure la perméabilité des caillots en vrac. Journal biophysique. 101(1-8):943-950. PMC317506 PMC3175063/PDF

Stephens, A., Haase, J., Vicci, L., Taylor II, R. et Bloom, K. (2011). La cohésine, la condensine et la boucle centromère intramoléculaire génèrent ensemble le ressort de la chromatine mitotique. Journal of Cell Biology.193(7):1167-1180. PMC3216333 PMC3216333/PDF

Swaminathan, V., Mythreye, K., O'Brien, E., Berchuck, A., Blobe, G., Superfine, R. (2011). La rigidité mécanique évalue le potentiel métastatique dans les cellules tumorales des patients et dans les lignées cellulaires cancéreuses. Recherche sur le cancer 71(15):5075-5080. PMC3220953 PMC3220953/PDF

Yemolenko, I.S., Alexander, F., Gorkun, O.V., Lishko, V.K., Lord, S.T., Ros, R., & Ugarova, T.P. (2011) Le rôle des domaines alpha C dans la formation de matrices de fibrinogène non adhésives. Du sang. 118(21):538

Young, J., & Mitran, S. (2011). Un algorithme continuum-microscopique pour la modélisation de milieux fibreux et hétérogènes avec des microstructures dynamiques. Modélisation et simulation multi-échelles SIAM.9(241-256) PDF

Campbell, R., Aleman, M., Gray, L., Falvo, M. et Wolberg, A. (2010). Le flux influence profondément la structure du réseau de fibrine : Implications pour la formation de fibrine et la stabilité du caillot dans l'hémostase. Journal of Thrombosis and Haemostasis. 104(6) :1281-1284. PMC3236083 PMC3236083/PDF

Carlisle, R.C., Sparks, E.A., Der Loughian, C., & Guthold, M. (2010). Résistance et défaillance des points de dérivation de la fibre de fibrine. Journal of Thrombosis and Haemostasis.8(5) :1135-1138.PMC3013622 PMC3013622/PDF

Chehetri, R., Carpenter, J., Superfine, R., Randell, S., & Oldenburg, A. (2010). Élastographie par cohérence optique magnétomotrice pour relier la structure et la fonction pulmonaires dans la mucoviscidose. Actes de SPIE. Vol. 7554. PMC3268340 PMC3268340/PDF

Cribb, J., Meehan, T., Shah, S., Skinner, K. et Superfine, R. (2010). Cylindres vs Sphères : Amincissement par cisaillement de biofluide dans le transport de nanoparticules entraîné. Annales de génie biomédical. 38(11):3311-3322. PMC3858002 PMC3858002/PDF

Falvo, M., Gorkun, O., & Lord. S. (2010). Les origines moléculaires des propriétés mécaniques de la fibrine. Chimie biophysique. Nov152(1-3):15-20. PMC2975759 PMC2975759/PDF

Feasel, J., Whitton, M., Kassler, L., Brooks, F. et Lewek, M. Le système de tapis roulant de réhabilitation d'environnement virtuel intégré. Transactions IEEE sur les systèmes neuronaux et l'ingénierie de réadaptation.19: 290-297. PDF

Feng, D., Kwock, L., Lee, Y., & Taylor II, R. M. (2010). Visualisations exploratoires liées pour les données de spectroscopie IRM incertaines. Actes de la Conférence sur la visualisation et l'analyse des données (SPIE).7530:12 pages.PMC2997734 PMC2997734/PDF

Feng, D., Lee, Y., Kwock, L. et Taylor II, R. (2010). Faire correspondre la saillance visuelle à la confiance dans les tracés de données incertaines. Transactions IEEE sur la visualisation et l'infographie (visualisation des actes/visualisation de l'information). 16(6):980-989. PMC3179257 PMC3179257/PDF

Hackney, Z., Mair, L., Skinner, K., Washburn, S. (2010). Propriétés photoconductrices et de polarisation de nanofils de CdTe individuels. Lettres de matériaux.64(18) 2016-2018. PMC2920430 PMC2920430/PDF

Hall, A. R., An, L., Liu, J., Vicci, L., Falvo, M. R., Superfine, R., Washburn, S. (2010). Mesure expérimentale des propriétés de torsion des nanotubes de carbone à paroi simple. Physical Review Letters.96(25):256102. PMC3274556 PMC3274556/PDF

Hart, G., Shi, Y., Zhu, H., Sanchez, M., Styner, M. et Niethammer, M. (2010). Construction de l'atlas longitudinal du DTI en tant que moyenne des modèles de croissance. Calcul d'images médicales et intervention assistée par ordinateur, Atelier sur l'analyse d'images spatio-temporelles pour les données d'images longitudinales et temporelles. NIHMS337251 PDF

Hill, D., Swaminathan, V., Estes, A., Cribb, J., O&8217Brien, E., Davis, C., Boucher, R., & Superfine, R. (2010). Génération de force et dynamique des cils individuels sous chargement externe. Journal biophysique 6 : 98 (1) : 57-66. PMC2800978 PMC2800978/PDF

Houser, J., Hudson, N., Ping, L., O'Brien, E., Superfine, R., Lord, S., & Falvo, M. (2010). Preuve que la région C est à l'origine d'un module faible, d'une extensibilité élevée et d'un raidissement des contraintes dans les fibres de fibrine. Journal biophysique. 99(9) : 3038-3047. PMC2965937 PMC2965937/PDF

Hudson, N., Houser, J., O'Brien, E., Taylor, R., Superfine, R., Lord, S., & Falvo, M. (2010). Le raidissement des fibres de fibrine individuelles répartit équitablement la contrainte et renforce les réseaux. Journal biophysique 98(8) : 1632-1640. PMC2856168 PMC2856168/PDF

Kassler, L., Feasel, J., Lewek, M., Brooks, F., & Whitton, M. Correspondance de la vitesse de marche réelle sur tapis roulant et de la vitesse de marche visuellement perçue dans un environnement virtuel de projection. Actes du 7e Symposium ACM sur la perception appliquée dans les graphiques et la visualisation LosAngeles CA:161-161 PDF

Liu, X., Davis, B., Niethammer, M., Pizer, S., Mageras, G. (2010). Formation d'atlas de mouvement respiratoire guidé par la prédiction pour la radiothérapie guidée par image 4D dans le poumon. MICCAI, Atelier international sur l'analyse d'images pulmonaires. NIHMS337269 (non accepté par PMC) PDF

Liu, W., Carlisle, R.C., Sparks, E.A., & Guthold, M. (2010). Les propriétés mécaniques des fibres de fibrine simples. Journal of Thrombosis and Haemostasis.8(5) :1030-1036.PMC3010862 PMC3010862/PDF

Liu, Y., Lin, X., Upadhyaya, M., Song, Q., & Chen, K. (2010) Tumeurs mucineuses papillaires intracanalaires du pancréas : corrélation des caractéristiques CT hélicoïdales avec les résultats pathologiques. Journal européen de radiologie. 76(2):222-227 PDF

Niethammer, M., Borland, D., Marron, S., Woosley, J. et Thomas, N. (2010). Normalisation de l'apparence des lames d'histologie. Imagerie médicale et intervention assistée par ordinateur, Atelier sur l'apprentissage automatique en imagerie médicale.6357:58-66. NIHMS337285 PDF

Nunes, J., Herlihy, K. P., Mair, L. O., Superfine, R., & DeSimone, J. M. (2010). Particules composites magnéto-polymères spécifiques de forme et de taille multifonctionnelles. Nano lettres.10(4):1113-1119.PMC3357060 PMC3357060/PDF

Peck, T., Fuchs, H., & amp Whitton, M. (2010). Redirection améliorée avec des distracteurs : un système de locomotion à grande échelle et son effet sur la navigation dans les environnements virtuels. Actes de IEEE Virtual Reality 2010 (Waltham, MA mars 2010), 35-38. PDF

Quammen, C. et Taylor II, R. (2010). « Adaptation du cadre d'enregistrement ITK pour s'adapter aux modèles d'images paramétriques », Kitware Source. (16) : 9-12. PMC3322640 PMC3322640/PDF

Shields, A. R., Fiser, B. L., Evans, B.A., Falvo, M.R., Washburn, S., & Superfine, R. Les réseaux de cils biomimétiques génèrent des régimes de pompage et de mélange simultanés. Actes de l'Académie nationale des sciences du 7 septembre 2010.107 : 15670-15675.PMC2936597 PMC2936597/PDF

Taylor II, R. M., Jerald, J., VanderKnyff, C., Wendt, J., Borland, D., Marshburn, D., Sherman, W. R., Whitton, M. C. (2010). Leçons sur les systèmes logiciels d'environnement virtuel de 20 ans de construction VE. Présence 19(2) : 163-178. PMC2887604 PMC2887604/PDF

Wendt, J., Whitton, M. C. et Brooks, F. B. (2010). GUD WIP: Gait-Understanding-Driven Walking-In-Place.Proceedings of IEEE Virtual Reality 2010 (Waltham, MA mars 2010), 51-58. NIHMS599421 PDF

Young, J., & Mitran, S. (2010). Un modèle numérique de blebbing cellulaire. Un modèle d'interaction fluide-structure à conservation de volume de la cellule entière. Journal de biomécanique. (43):210-220. PMC2813352 PMC2813352/PDF

Campbell, R.A., Overmyer, K.A., Selzman, C.H., Sheridan, B.C., & amp Wolberg, A.S. (2009). Contributions des cellules extravasculaires et intravasculaires à la formation, à la structure et à la stabilité du réseau de fibrine. Sang.114(23):4886-4896.PMC2786294 PMC2786294/PDF

Carlisle, C.R., Coulais, C., Namboothiry, M., Carroll, D.L., Hantgan, R.R., & Guthold, M. (2009). Les propriétés mécaniques des fibres individuelles de fibrinogène électrofilées. Biomatériaux.30(6) :1205-1213.PMC3012557 PMC3012557/PDF

Chourasia, A., & Taylor II, R. Concours de conception IEEE Visualization 2008. IEEE CG&A Visualization Viewpoints Mai/Juin 2009.29:pp. 86-87

Darling, E. M., P. E. Pritchett, Evans, B., Superfine, R., Zausher, S., & Guilak, F. (2009). Propriétés mécaniques et expression génique des chondrocytes sur des substrats à micromotifs après dédifférenciation en monocouche. Bioingénierie cellulaire et moléculaire 2(3) : 395-404. PMC2898162 PMC2898162/PDF

Dedeugd, C., Wankhede, M., & Sorg, B.S. (2009). Imagerie optique multimodale de la dynamique du transport convectif de l'oxygène dans les réseaux de microvaisseaux. Optique appliquée.48(10):D187-197. PDF

Feng, D., Kwock, L., Lee, Y.Z., & Taylor, R.M. (2009). Évaluation des techniques de visualisation de volume multivariées basées sur des glyphes. Actes du 6e Symposium sur la perception appliquée dans les graphiques et la visualisation 2009 : 61-68. PMC3087293 PMC3087293/PDF

Fisher, J.K., Ballenger, M., O&8217Brien, E.T., Haase, J., Superfine, R., & Bloom, K. (2009). Dynamique de relaxation de l'ADN comme sonde pour l'environnement intracellulaire. Actes de l'Académie nationale des sciences 106(23): 9250-9255. PMC2695107 PMC2695107/PDF

Fricks, J., Yao, L. X., Elston, T. C., & Forest, M. G. (2009). Méthodes de domaine temporel pour le transport diffusif dans la matière molle. Journal SIAM sur les mathématiques appliquées.69(5):1277-1308 PDF

Gerardin, E., Chetelat, G., Chupin, M., Cuingnet, R., Desgranges, B., Kim, HS, Niethammer, M., Dubois, B., Lehericy, S., Garnero, L., Eustache , F., Colliot, O., Alzheimer’s Dis Neuroimaging, I. (2009). La classification multidimensionnelle des caractéristiques de la forme de l'hippocampe distingue la maladie d'Alzheimer et les troubles cognitifs légers du vieillissement normal. Neuroimage.47(4):1476-1486.PMC3001345 PMC3001345/PDF

Ghosh, S., Dutta, S., Gomes, E., Carroll, D., D’Agostino Jr., R., Olson, J., Guthold, M., & Gmeiner, W.H. (2009). Efficacité de chauffage accrue et ablation thermique sélective des tissus malins avec des nanotubes de carbone à parois multiples enrobés d'ADN. ACS Nano.3(9) :2667-2673.PMC2748720 PMC2748720/PDF

Grubb, B.R., Rogers, T.D., Boucher, R.C., & Ostrowski, L.E. (2009). Transport d'ions à travers la mucoviscidose et l'épithélium olfactif et cilié murin normal. American Journal of Physiology – Cell Physiology.296(6):C1301-C1309.PMC2692423 PMC2692423/PDF

Hinczewski, M., Schlagberger, X., Rubinstein, M., Krichevsky, O., Netz, R. R. (2009). Dynamique des monomères finaux dans les polymères semi-flexibles. Macromolécules.42(3):860-875.PMC3043606 PMC3043606/PDF

Jerald, J., Steinicke, F., & Whitton, W. Les seuils de mouvement de scène sont en corrélation avec les mouvements angulaires de la tête pour les environnements virtuels immersifs. IEEE Advances in Computer-Human Interaction 2009:69-75 PDF

Jerald, J., & Whitton, M. (2009). Relier les seuils de mouvement de scène aux seuils de latence pour les visiocasques. Actes de la réalité virtuelle IEEE Lafayette, LA. 211-218 mars. PMC3095496 PMC3095496/PDF

Jerald, J. Instabilité de la scène pendant le retournement de la tête. Actes de l'atelier IEEE VR sur les illusions perceptives dans les environnements virtuels 2009 Lafayette, LA PDF

Kaplan, E., Min, J. -Y., Ke, Q., Chen, Y., Niethammer, M., Rana, J. S., Malek, S., Verheugt, F. W. A., & Morgan, J. P. (2009). Le calcium et les nucléotides cycliques affectent la migration des cellules souches induite par le TNF-alpha. Communications de recherche biochimique et biophysique.382:241-246.PMC2941773 PMC2941773

Kohli, L. Exploiter les illusions perceptives pour améliorer l'haptique passive. Atelier IEEE VR sur les illusions perceptives dans les environnements virtuels 2009 Lafayette, LA PDF

Levitt, JJ, Styner, M., Niethammer, M., Bouix, S., Koo, MS, Voglmaier, MM, Dickey, CC, Niznikiewicz, MA, Kikinis, R., McCarley, RW, Shenton, ME (2009) . Anomalies de forme du noyau caudé dans le trouble de la personnalité schizotypique.Recherche sur la schizophrénie.110(1-3):127-139.PMC2756791 PMC2756791/PDF

Lindley, B., Howell, E.L., Smith, B.D., Rubinstein, G.J., Forest, M.G., Mitran, S.M., Hill, D.B., & Superfine, R. (2009). Communication des contraintes et filtrage des couches viscoélastiques en cisaillement oscillatoire. Journal of Non-Newtonian Fluid Mechanics 156(1-2): 112-120. PDF

Livraghi, A., Grubb, B.R., Hudson, E.J., Wilkinson, K.J., Sheehan, J.K., Mall, M.A., O’Neal, W.K., Boucher, R.C., & Randell, S.H. (2009). Pathologie des voies respiratoires et des poumons due à la déshydratation de la surface de la muqueuse chez -souris épithéliales surexprimant le canal Na+ : rôle du TNF- et IL-4R signalisation, influence du développement néonatal et efficacité limitée du traitement par glucocorticoïdes. Le Journal d'immunologie. 182 (7) : 4357-4367. PMC2659461 PMC2659461/PDF

Macenko, M., Niethammer, M., Marron, J.S., Borland, D., Woosley, J.T., Guan, X., Schmitt, C., & Thomas, N.E. (2009). Une méthode pour normaliser les lames d'histologie pour l'analyse quantitative. Symposium international sur l'imagerie biomédicale.1107-1110

Mair, L., Ford, K., Alam, R., Kole, R., Fisher, M., & Superfine, R. (2009). Particules de taille uniforme à 200 nm : fabrication et application à la magnétofection. Journal of Biomedical Nanotechnology 5: 182-191. PMC2818021 PMC2818021/PDF

Mair, L., Skinner, K., Donley, C.L., Superfine, R. (2009). Nanofils Au-CdTe-Au électrodéposés : contrôle par solution de la stoechiométrie Cd/Te. Transactions de la société électrochimique (19(3)): 99-109.

McKinley, S., Yao, L., & Forest, M. (2009). Diffusion anormale transitoire de particules traceuses dans la matière molle. Journal de rhéologie. (53):1487-1506 PDF

Niethammer, M., Zach, C., Melonakos, J., Tannenbaum, A. (2009). Segmentation des faisceaux de fibres quasi tubulaires pour l'imagerie pondérée en diffusion : segmentation par réorientation du cadre. Neuroimage.45(1):S123-S132.PMC2774769 PMC2774769/PDF

Peck, T.M., Fuchs, H., & Whitton, M.C. (2009). Évaluation des techniques de réorientation et des distracteurs pour la marche dans de grands environnements virtuels. Transactions sur la visualisation et l'infographie 15(3) : 383-394. PMC2844119 PMC2844119/PDF

Peck, T., Fuchs, H., & Whitton, M.C. (2009). Redirection améliorée avec des distracteurs : un système de locomotion à grande échelle et son effet sur la navigation dans les environnements virtuels. Conférence de réalité virtuelle (VR) IEEE.35-38 PDF

Quammen, C., Feng, D., & Taylor II, R. M. Performance des algorithmes de déconvolution 3D sur des architectures multicœurs et multicœurs. UNC-Chapel Hill Department of Computer Science Technical Report.TR-09-001 PDF

Reuter, M., Wolter, F. E., Shenton, M., Niethammer, M. (2009). Valeurs propres de Laplace-Beltrami et caractéristiques topologiques des fonctions propres pour l'analyse statistique de forme. Conception assistée par ordinateur.41(10) :739-755.PMC2753296 PMC2753296/PDF

Taylor II, RM, Robinett, W., Chi, VL, Brooks Jr., FP, Wright, WV, Williams, RS, Snyder, RJ, Chen, J., Okimoto, S., Llopis-Artime, N., Falvo , M., Paulson, S., Thiansathaporn, P., Glick, D., Washburn, S., Superfine, R., Jen, D., Parente, P., Robbins, J., Weigle, C., Burette , A., Weinberg, R., Varadhan, G., & Erie, D. Systèmes intégrés par ordinateur pour la microscopie et la manipulation. Exposition Découverte IEEE VisWeek 2009 2009 : 2 pages PDF

Voineskos, AN, O’Donnell, LJ, Lobaugh, NJ, Markant, D., Ameis, SH, Niethammer, M., Mulsant, BH, Pollock, BG, Kennedy, JL, Westin, CF, Shenton, ME (2009) . Examen quantitatif d'une nouvelle méthode de clustering utilisant la tractographie du tenseur de diffusion par résonance magnétique. Neuroimage.45(2):370-376.PMC2646811 PMC2646811/PDF

Wirtz, D. (2009) Microrhéologie de suivi des particules des cellules vivantes : principes et applications. Revue annuelle de Biophysique. 38:301-326 PDF

Zach, C., Niethammer, M., & Frahm, J. M. (2009). Flux maximaux continus et formes de Wulff : applications aux MRF. Actes de la Conférence sur la vision par ordinateur et la reconnaissance de formes (CVPR).1911-1918 PDF

Zach, C., Shan, L. et Niethammer, M. (2009). Contours actifs Finsler globalement optimaux. Actes du Symposium sur la reconnaissance des formes de l'Association allemande pour la reconnaissance des formes (DAGM).5748:552-561 PDF

Zhang L, B. B., Gabriel SE, Burkett S, Yan Y, Skiadopoulos MH, Dang YL, Vogel LN, McKay T, Mengos A, Boucher RC, Collins PL, Pickles RJ. (2009). L'administration de CFTR à 25 % des cellules épithéliales de surface rétablit les taux normaux de transport de mucus vers l'épithélium des voies respiratoires de la fibrose kystique humaine. PLOS Biologie. (7).PMC2705187 PMC2705187/PDF

Button, B., Boucher, R.C. (2008). Rôle du stress mécanique dans la régulation de l'hydratation de la surface des voies respiratoires et des taux de clairance du mucus. Respir Physiol Neurobiol.163(1-3):189-201. PMC2645865

Cakici, S.S. Sezerman, U., & Balcisoy, S. (2008) DockPro : Un outil basé sur la réalité virtuelle pour les problèmes d'amarrage protéine-protéine. Le Journal international de la réalité virtuelle. 8(Numéro2-2009/4):19-23.

Campbell, R.A., Overmyer, K.A., Bagnell, C.R., & amp Wolberg, A.S. (2008) L'activité procoagulante cellulaire dicte la structure et la stabilité du caillot en fonction de la distance par rapport à la surface cellulaire. Artériosclérose, thrombose et biologie vasculaire. 28(12):2247-2254. PMC2773697
publication PMC2773697

Davis, C.W., & Lazarowski, E. (2008). Couplage de l'activité ciliaire des voies aériennes et de la sécrétion de mucine aux contraintes mécaniques par signalisation purinergique. Physiologie respiratoire Neurobiologie. (163) :1-3. PMC2583098

Davis, C.W., & Dickey, B.F. (2008) Sécrétion de mucine des cellules caliciformes des voies respiratoires régulée. Revue annuelle de physiologie. 70 : 487-512.
publication 17988208

Desai, KV, Bishop, TG, Vicci, L., O’Brien, ET, Taylor II, R., & Superfine, R. (2008) Suivi des particules agnostiques pour le mouvement tridimensionnel des granules cellulaires et la dynamique des billes membranaires . Journal biophysique. 94(6) : p. 2374-84. PMC2257905

Desprat, N., Supatto, W., Pouille, P.A., Beaurepaire, E., & Farge, E. (2008) La déformation des tissus module l'expression de la torsion pour déterminer la différenciation de l'intestin moyen antérieur chez les embryons de drosophile. Cellule de développement. 15(3):470-477.

Falvo, M.R., Millard, D., O&8217Brien, E.T., Superfine, R., & Lord, S.T. (2008) La longueur des répétitions en tandem dans la région alphaC de la fibrine est en corrélation avec l'extensibilité des fibres. Journal of Thrombosis and Haemostasis. 2008. PMC2655637

Feasel, J., M.C. Whitton et J.D. Wendt. LLCM-WIP : faible latence, mouvement continu sur place. Actes du Symposium IEEE sur les interfaces utilisateur 3D. 2008. 97-104.

Feng, D., Y. Lee, L. Kwock et Taylor R.M. II. Visualisation de volume scalaire multivariée pour l'estimation de la relation et de la valeur. Transactions sur la visualisation et l'infographie. 2008.

Hohenegger, C., Forest, M. (2008). Microrhéologie à deux billes : protocoles de modélisation. Examen physique. E, Physique statistique, non linéaire et de la matière molle.78 (3 Pt 1) : 031501.PMC2692253

Huang, B., Jones, S.A., Brandenburg, B., & Zhuang, X. (2008) Whole-cell 3D STORM révèle des interactions entre les structures cellulaires avec une résolution à l'échelle nanométrique. Méthodes naturelles. 5(12)1047-1052. PMC2596623
publication PMC2596623

Jerald, J., T.M. Peck, F. Steinicke et M. Whitton. Sensibilité au mouvement de la scène pour les phases de pian de la tête. Actes de la perception appliquée dans les graphiques et la visualisation. 2008.

Kharlampieva, E., Ankner, J.F., Rubinstein, M., & Sukhishvili, S.A. (2008) libération induite par le pH de polyanions à partir de films multicouches. Lettres d'examen physique. 100(12):128303

Kreda, S., Boucher, R.C., Lazarowski, E. (2008). Libération de nucléotides et physiologie épithéliale des voies aériennes. Nouvelles de physiologie. (71):19-22

Lan, Y., Elston, T.C., & Papoian, G.A. (2008) Élimination des variables rapides dans les équations chimiques de Langevin. Le Journal de Physique Chimique. 129(21):214115. PMC2674792

Lloyd, B., Govindaraju, N., Quammen, C., Molnar, S., Manocha, D. (2008) Logarithmic Perspective Shadow Maps. ACM Transactions de graphiques. 27(4)

Mihalik, J.P., L. Kohli et M.C. Whitton. Les caractéristiques physiques d'un appareil de réalité virtuelle contre-indiquent-elles son utilisation pour l'évaluation de l'équilibre ? Journal de rééducation sportive. 2008. 17(1) : p. 38-49.

Mitran, S., M.G. Forest, B. Lindley, L. Yao et D.B. Colline. Extensions du modèle d'onde de cisaillement de Ferry pour la microrhéologie linéaire et non linéaire active. Mécanique des fluides non newtonienne. 2008. PMC2790219

Nie, Z., Fava, D., Rubinstein, M., & Kumacheva, E. (2008) “Supermolecular” assembly of gold nanotiges end-termed with plymer “pom-poms”: effect of pom-pom structure sur les modes d'association. Journal de la société chimique américaine. 130(11):3683-3689.

O’Brien, E.T., 3e, M.R. Falvo, D. Millard, B. Eastwood, R.M. Taylor, 2e, et R. Superfine. Feuilles de fibrine ultrafines auto-assemblées. Proc Natl Acad Sci U S A. 2008. 105(49): p. 19438-43. PMC2614779

O&8217Brien, E.T., J. Cribb, D. Marshburn, R.M. Taylor, 2e, et R. Superfine. Chapitre 16 : Manipulation magnétique pour les mesures de force en biologie cellulaire. Méthodes Cell Biol. 2008. 89: p. 433-50.

Peck, T.M., M.C. Whitton et H. Fuchs, Évaluation des techniques de réorientation pour la marche dans de grands environnements virtuels, dans Actes de la réalité virtuelle IEEE. 2008 : Reno, NV. p. 121-127.

Quammen, C.W. et R.M. Taylor II. image de couverture sur la biologie actuelle. 2008.

Quammen, C.W., richardson, A.C., Haase, J., Harrison, B.D., Taylor, R.M., & Bloom, K.S. (2008) FluoroSim: A Visual Problem-Solving Environment for Fluorescence Microscopy, dans les actes du Atelier Eurographics sur l'informatique visuelle pour la biomédecine, Delft, Pays-Bas, 6-7 octobre 2008, p. 151-158. PMC2860625

Shusharina, N.P., & Rubinstein, M. (2008 Concentration regimes in solutions of polyelectrolyte stars. Macromolecules. 41(1):203-217.

Sonnenwald, D.H., M.C. Whitton et K. Maclaughlin, Évaluation d'un système de collaboration scientifique : étudier le potentiel d'un projet de collaboration avant le déploiement, dans Sciences sur Internet, G. Olson, A. Zimmerman et N. Bos, éditeurs. 2008, MIT Press : Boston.

Spero, R.C., L. Vicci, J. Cribb, D. Bober, V. Swaminathan, E.T. O&8217Brien, S.L. Rogers et R. Superfin. Système à haut débit pour la manipulation magnétique de cellules, polymères et biomatériaux, polymères et biomatériaux. Rev Sci Instrument. 2008. 79(8) : p. 083707. PMC2748383

Spero, R., & amp Taylor II, R. (2008) La topographie à potentiel scalaire peut simplifier l'interprétation des champs de vecteurs 2D. Rapport technique sur l'informatique de l'UNC.

Spero, R.C., Wolberg, A., Lord, S., & Superfine, R. (2008). “Dépistage à haut débit des caillots de fibrine : transport et mécanique mesurés par des microbilles.” Résumés de sang.

Superfine, R., Swaminathan, V., O’Brien, E.T., Boucher, R., Button, B., & Estes, A. Force de décrochage et réponse des cils pulmonaires. American Physical Society, réunion de mars 2008 de l'APS. 2008.

Taylor, A.C.a. R. (2009). Concours de conception IEEE Visualization 2008. Points de vue de visualisation IEEE CG&A. Vol. 29, n° 3 : pp. 86-87.

Taylor, R.C.S.a. R.M. (2008). “La topographie potentielle scalaire peut simplifier l'interprétation des champs vectoriels 2D.” Rapport technique sur l'informatique de l'UNC #RT08-008.

Taylor, R. M., 2e (2008). Haptique pour la visualisation scientifique. Rendu haptique : fondements, algorithmes et applications. M. Lin et M. Otaduy, A.K. Peters LTD.

Visnapuu, M.L., Fazio, T., Wind, S., & Greene, E.C. (2008) Réseaux parallèles de nanopuits géométriques pour l'assemblage de rideaux d'ADN avec dispersion latérale contrôlée. Langmuir. 24(19):11293-11299. PMC2748852

Whitton, M.C. et S. Razzaque, Locomotion, dans HCI au-delà de l'interface graphique : conception pour les interfaces haptiques, vocales, olfactives et autres interfaces non traditionnelles, P. Kortum, éditeur. 2008, Morgan Kaufmann : Burlington, MA. p. 107-146.

Whitton, M. et F. Brooks, Evaluating VE Component Technologies, dans Composants VE et technologies de formation, D. Nicholson, J. Cohn et D. Schmorrow, éditeurs. sous presse, Praeger Security International : Westport, CN.

Whitton, M. et J.D. Wendt (2008). Modélisation et rendu. Environnements virtuels pour la formation et l'éducation : développements pour les militaires et au-delà. D. Nicholson, D. Schmorrow et J. Cohen. Westport, CN, Praeger Security International. 2: 15-20.

Whitton, M. et Loftin, R.B., Section Perspective : Virtual Environment Component Technologies, dans Composants VE et technologies de formation, D. Nicholson, J. Cohn et D. Schmorrow, éditeurs. sous presse, Praeger Security International : Westport, CN.

Wong, O.K., Guthold, M., Erie, D.A., & Gelles, J. (2008) Interconvertible Lac Repressor-DNA Loops Revealed by Single-Molecule Experiments. Biologie PLoS. 6(9) :e232. PMC2553838

Zach, C, Gallup, D., Frahm, J. M., Niethammer, M. Étiquetage global rapide pour la stéréo en temps réel utilisant plusieurs balayages de plan. Atelier Vision, Modélisation et Visualisation 2008.

Zuo, P., Picher, M., Okada, S.F., Lazarowski, E.R., Button, B., Boucher, R.C., Elston, T.C. (2008). Modèle mathématique de régulation nucléotidique sur l'épithélium des voies aériennes. Implications pour l'homéostasie des voies aériennes. Journal de chimie biologique. 283(39): 26805-26819. PMC2546543

Abdullah, L.H. et C.W. Davis. Régulation de la sécrétion de mucine des cellules caliciformes des voies respiratoires par les voies de signalisation de la phosphorylation de la tyrosine. Am J Physiol Lung Cell Mol Physiol. 2007. 293(3) : p. L591-9.

Borland, D. et M.R. Taylor, 2e. Carte de couleur arc-en-ciel (encore) considérée comme nuisible. Application IEEE Comput Graph. 2007. 27(2) : p. 14-7.

Boucher, R.C. Preuve de la déshydratation de la surface des voies respiratoires comme événement déclencheur de la maladie des voies respiratoires FK. J Stagiaire Med. 2007. 261(1) : p. 5-16.

Boucher, R.C. Déshydratation de la surface des voies aériennes dans la mucoviscidose : pathogenèse et thérapie. Annu Rev Med. 2007. 58: p. 157-70.

Boucher, R.C. La mucoviscidose : une maladie de vulnérabilité à la déshydratation de la surface des voies respiratoires. Tendances Mol Med. 2007. 13(6) : p. 231-40.

Boucher, R.C. Preuve de la déshydratation de la surface des voies respiratoires comme événement déclencheur de la maladie des voies respiratoires FK. J Stagiaire Med. 2007. 261(1) : p. 5-16.

Bouzarth, E.L., A. Brooks, R. Camassa, H. Jing, T.J. Leiterman, R.M. McLaughlin, R. Superfine, J. Toledo et L. Vicci. Orbites épicycloïdales dans un fluide visqueux autour d'une tige en précession : théorie et expérimentations aux micro et macro-échelles. Phys Rev E Stat Nonlin Phys Matière Molle. 2007. 76(1pt 2) : p. 016313.

Burette, A., D. Feng, D. Marshburn, D. Jen, R. Weinberg et R.M.T. II. Boîte à outils : entrer dans la troisième dimension. Journal des neurosciences. 2007. 27: p. 12757 – 12760.

Burns, E., S. Razzaque, M. Whitton et F. Brooks. MACBETH : L'avatar que je vois devant moi et son mouvement vers ma main (Poster Abstract). dans IEEE Réalité Virtuelle 2007. 2007. Charlotte, Caroline du Nord : IEEE.

Button, B., M. Picher et R.C. Boucher. Effets différentiels du stress cyclique et constant sur la libération d'ATP et le transport mucociliaire par l'épithélium des voies respiratoires humaines. J Physiol. 2007. 580(partie 2) : p. 577-92.

Cribb, J., D. Hill, R.M. Taylor II, L. Vicci, J.K. Fisher, K. Desai, M.G. Forest, et R. Superfine. Rhéologie Non Linéaire Des Solutions Lambda-ADN Enchevêtrées Via Driven Microbead Rheology. dans Réunion annuelle de la société biophysique. 2007. Baltimore, MD.

Cribb, J., B. David, R.M. Taylor, L. Vicci, J. Fisher, K.V. Desai, M.G. Forest et R. Superfine. Rhéologie non linéaire des solutions lambda-ADN intriquées via la rhéologie des microbilles entraînées. Journal biophysique. 2007 : p. 638A-638A.

Desai, K.V., E.T. O&8217Brien, J. Cribb et R. Superfine. La réponse au fluage cellulaire non linéaire dépend de l'ancrage membranaire : une étude de la force magnétique. dans Réunion de la société de biophysique. 2007. Baltimore, Maryland : Journal biophysique.

Desai, K.V., E.T. O&8217Brien, J. Cribb et R. Superfine. La réponse au fluage cellulaire non linéaire dépend de l'ancrage membranaire : une étude de la force magnétique. Journal biophysique. 2007 : p. 420a-420a.

Eastwood, B. et R.M. Taylor. Élimination de l'occlusion en vidéomicroscopie. Analyse informatique d'images et de motifs, Springer Berlin. 2007. 4673: p. 125�.

Evans, B.A., A.R. Shields, R.L. Carroll, S. Washburn, M.R. Falvo et R. Superfine. Réseaux de nanotiges actionnés magnétiquement sous forme de cils biomimétiques. Nano Lett. 2007. 7(5) : p. 1428-34.

Feng, D., D. Marshburn, D. Jen, R.J. Weinberg, R.M. Taylor, 2e, et A. Burette. Entrer dans la troisième dimension. J Neurosci. 2007. 27(47) : p. 12757-60.

Fisher, J.K., L. Vicci, K. Bloom, E.T. O&8217Brien, C.W. Davis, R.M. Taylor II et R. Superfine, Manipulation magnétique pour les sciences biomédicales, dans Manuel des nanosciences, de l'ingénierie et de la technologie, deuxième édition. 2007, CRC Press LLC : Boca Raton.

Glencross, M., C. Jay, J. Feasel, L. Kohli, M.C. Whitton et R. Hubbold. Interaction haptique coopérative efficace sur Internet. dans Actes de IEEE Virtual Reality 2007. 2007.

M. Guthold, W. Liu, EA Sparks, LM Jawerth, L. Peng, M. Falvo, R. Superfine, RR Hantgan, ST Lord (2007) « Une comparaison des propriétés mécaniques et structurelles des fibres de fibrine avec d'autres fibres de protéines » Biochimie cellulaire et biophysique 49, 165-181.

Guthold, M., W. Liu, E.A. Sparks, L.M. Jawerth, L. Peng, M. Falvo, R. Superfine, R.R. Hantgan et S.T. Seigneur. Une comparaison des propriétés mécaniques et structurelles des fibres de fibrine avec d'autres fibres protéiques. Cellule Biochem Biophys. 2007. 49(3) : p. 165-81.

Hall, A.R., M.R. Falvo, R. Superfine et S. Washburn. Réponse électromécanique des nanotubes de carbone à paroi simple à la contrainte de torsion dans un dispositif autonome. Nature Nanotechnologie. 2007. 2: p. 413-416.

Hickey, A.J., H.M. Mansour, M.J. Telko, Z. Xu, H.D. Smyth, T. Mulder, R. McLean, J. Langridge et D. Papadopoulos. Caractérisation physique des particules constituantes incluses dans les inhalateurs de poudre sèche. I. Revue de la stratégie et caractéristiques statiques. J Pharm Sci. 2007. 96(5) : p. 1282-301.

Hirsh, A.J., J.R. Stonebraker, C.A. van Heusden, E.R. Lazarowski, R.C. Boucher et M. Picher. L'adénosine désaminase 1 et les transporteurs concentrés de nucléosides 2 et 3 régulent l'adénosine sur la surface apicale de l'épithélium des voies respiratoires humaines : implications pour les maladies pulmonaires inflammatoires. Biochimie. 2007. 46(36) : p. 10373-83.

Jerald, J., A. Fuller, A. Lastra, M.C. Whitton, L. Kohli et F.P. Brooks. Compensation de latence par sélection de ligne de balayage horizontale pour les visiocasques. dans Actes des écrans stéréoscopiques et des systèmes de réalité virtuelle SPIE Vol 6490. 2007.

Kreda, S.M., S.F. Okada, Californie van Heusden, W. O&8217Neal, S. Gabriel, L. Abdullah, C.W. Davis, R.C. Boucher et E.R. Lazarowski. Libération coordonnée de nucléotides et de mucine à partir de cellules épithéliales Calu-3 des voies respiratoires humaines. Journal de Physiologie. 2007. 584(partie 1) : p. 245-59. PMC2277076

Liu, W., Bonin, K. Guthold, M. (2007) "Une méthode simple et directe pour calibrer les mesures de force latérale AFM" Review of Scientific Instruments 78, 063707 (7 pages)

Mitran, S. Modèle informatique de la clairance mucociliaire – Pertinence pour la thérapie. Pneumologie pédiatrique. 2007 : p. 111-112.

Mitran, S.M. Formation d'ondes métachronales dans un modèle de cils pulmonaires. Structure de calcul. 2007. 85(11-14): p. 763-774.

O&8217Brien, E.T., III, B. Wilde, S. Massenburg, K. Desai, R.M. Taylor, II, D. Marshburn et R. Superfine. La réponse au fluage cellulaire non linéaire dépend de l'ancrage membranaire : une étude de la force magnétique. dans Réunion de la société de biophysique. 2007. Baltimore, Maryland : Journal biophysique.

Peng, L., Stephens, B. J., Bonin, K., Cubicciotti, R., Guthold, M., (2007) « NanoSelection® – a Novel, Seul-Méthode de cycle à sélectionner Individuel Espèces d'aptamère d'un petit groupe d'oligonucléotides aléatoires "Recherche et technique en microscopie 70, 372-381

Peng, L., B.J. Stephens, K. Bonin, R. Cubicciotti et M. Guthold. Une technique combinée de microscopie à force atomique/fluorescence pour sélectionner des aptamères en un seul cycle à partir d'un petit groupe d'oligonucléotides aléatoires. Microsc Res Tech. 2007. 70(4) : p. 372-81.

Rubinstein, M. Physique des polymères de la couche perciliaire. Pneumologie pédiatrique. 2007 : p. 112-113.

Sears, P.R., K. Thompson, M.R. Knowles et C.W. Davis. Modèle empirique de la dynamique ciliaire pour l'épithélium des voies respiratoires humaines. Journal biophysique. 2007 : p. 486A-486A.

Boucliers, A.R. Réseaux de nanotiges à action magnétique en tant que Silia biomimétique. Nano lettres. 2007. 7(5) : p. 1428-1434.

Spero, R.C., B. Smith, L. Vicci, J. Cribb, E.T. O’Brien, S.T. Lord, et R. Superfine. Rhéologie des microbilles à haut débit des gels de fibrine. dans Réunion de la société de biophysique. 2007. Baltimore, Maryland : Journal biophysique.

Spero, R.C., B. Smith, L. Vicci, J. Cribb, E.T. O’Brien, S.T. Lord, et R. Superfine. Rhéologie de microbilles à haut débit de gels de fibrine. Journal biophysique. 2007 : p. 521a-521a.

Sun, F.C., A.V. Dobrynin, D. Shirvanyants, H.I. Lee, K. Matyjaszewski, G.J. Rubinstein, M. Rubinstein et S.S. Sheiko. Théorème de Flory pour les mélanges structurellement asymétriques. Lettres d'examen physique. 2007. 99(13).

Tanase, M., N. Biais et M. Sheetz. Brucelles magnétiques en biologie cellulaire. Méthodes Cell Biol. 2007. 83: p. 473-93.

Winters, S.L., C.W. Davis et R.C. Boucher. Mécanosensibilité de la fréquence des battements ciliaires trachéaux de souris : rôles pour Ca2+, signalisation purinergique, tonicité et viscosité. Am J Physiol Cellule pulmonaire Mol Physiol. 2007. 292(3) : p. L614-24.

Xu, K., M.G. Forêt, et I. Klapper. Sur la correspondance entre écoulements rampants de fluides visqueux et viscoélastiques. Journal de la mécanique des fluides non newtonienne. 2007. 145(2-3) : p. 150-172.

Asokan, S., R.L. Caroll, S. Washburn, R.E. Cheney et R. Superfine. Le flux de fluide peut orienter les filaments d'actine mobiles dans les canaux microfluidiques. Journal biophysique. 2006.

Burns, E. et F.P. Brooks Jr. Sensibilité perceptive à l'écart visuel/kinesthésique dans la vitesse de la main, et pourquoi nous pourrions nous en soucier. dans VRST 2006. 2006. Simassol, Chypre.

Burns, E., S. Razzaque, A.T. Panter, M.C. Whitton, M.R. McCallus et F.P. Brooks Jr. La main est plus facilement dupe que l'œil : les utilisateurs sont plus sensibles à l'interpénétration visuelle qu'à la divergence visuo-proprioceptive. Journal on Presence : téléopérateurs et environnements virtuels. 2006. 15(1) : p. 1-15.

Burns, E., S. Razzaque, M.C. Whitton et F.P. Brooks. MACBETH : Gestion du conflit d'avatar par l'emploi d'une technique hybride. Revue Internationale de Réalité Virtuelle. 2006. 6(2): p. 11-20. Brûlures2006

Cribb, J., D.B. Hill, J. Fisher, J. Sheehan, M. Rubinstein, M.G. Forest et R. Superfine. Contraste et comparaison des propriétés rhéologiques microscopiques et macroscopiques de l'ADN lambda et du mucus des voies respiratoires humaines. Journal biophysique. 2006.

Fielding, J.R., D. Borland, K.H. Lee, J.P. Clarke, E. Wallen, R. Pruthi et R.M. Taylor. Pyéloscopie virtuelle par peeling volumétrique en profondeur. Acad Radiol. 2006. 13(6) : p. 759-63.

Fisher, J.K., J. Cribb, K.V. Desai, L. Vicci, B. Wilde, K. Keller, R.M. Taylor, J. Haase, K. Bloom, E.T. O’Brien et R. Superfine. Système de force magnétique à feuille mince pour la microscopie à grande ouverture numérique. Rev Sci Instrument. 2006. 77(2):

Fisher, J.K., L. Vicci, J. Cribb, E.T. O&8217Brien, R.M. Taylor et R. Superfin. Systèmes de micromanipulation à force magnétique pour les sciences biologiques. NANO. 2006. 1(3) : p. 191-205.

Hall, A.R., L. An, J. Liu, L. Vicci, M.R. Falvo, R. Superfine et S. Washburn. Mesure expérimentale des propriétés de torsion des nanotubes de carbone monoparoi. Phys Rev Lett. 2006. 96(25) : p. 256102.

Jones, M.G., M.R. Falvo, B.P. Broadwell et S. Dotger. Auto-assemblage – Comment la nature se construit. Le professeur de sciences. 2006.

Klapper, I., K. Xu et M.G. Forêt. Relations de réciprocité entre les écoulements de Stokes de fluides visqueux et viscoélastiques. Journal de la mécanique des fluides non newtonienne. 2006.

Liu, W., Jawerth, L. M., Sparks, E. A ., Falvo, M. R., Hantgan, R. R., Superfine, R., Lord, S. T., Guthold, M., (2006) « Fibrin Fibers have Extraordinary Extensibility and Elasticity » Science 313, 634

Liu, W., L.M. Jawerth, E.A. Sparks, M.R. Falvo, R.R. Hantgan, R. Superfine, S.T. Lord, et M. Guthold. Les fibres de fibrine ont une extensibilité et une élasticité extraordinaires. Science. 2006. 313(5787): p. 634.

Martin, J., Procedural House Generation: A method for dynamically generation plans d'étage (poster), en 2006 ACM Symposium on Interactive 3D Graphics and Games. 2006, ACM : Redwood City, Californie.

Matsui, H., V.E. Wagner, D.B. Hill, U.E. Schwab, T.D. Rogers, B. Button, R.M. Taylor, 2e, R. Superfine, M. Rubinstein, B.H. Iglewski et R.C. Boucher. Un lien physique entre la déshydratation de la surface des voies respiratoires de la mucoviscidose et les biofilms de Pseudomonas aeruginosa. Proc Natl Acad Sci U S A. 2006. 103(48) : p. 18131-6.

Muller, P., J. Cohn, D. Schmorrow, R. Stripling, K. Stanney, L. Milham, M.C. Whitton et J. Folks. La matrice de fidélité : mappage de la fidélité du système aux résultats de la formation. dans Actes de l'IITSEC 2007. 2006.

Peng, L., B.J. Stephens, K. Bonin, R. Cubicciotti et M. Guthold. Une technique combinée de microscopie à force atomique/fluorescence pour sélectionner des aptamères en un seul cycle à partir d'un petit groupe d'oligonucléotides aléatoires. Recherche et technique en microscopie. 2006.

Prakash, R., R. Superfine, S. Washburn et M.R. Falvo. Fonctionnalisation de nanotubes de carbone avec des protéines et des points quantiques dans des solutions tampons aqueuses. Lettres de physique appliquée. 2006. 88(063102).

Randell, S.H. et R.C. Boucher. Une élimination efficace du mucus est essentielle pour la santé respiratoire. Am J Respir Cell Mol Biol. 2006. 35(1) : p. 20-8.

Skinner, K., C. Dwyer et S. Washburn. Fonctionnalisation sélective de nanofils arbitraires. Nano Lett. 2006. 6(12) : p. 2758-62.

Sonnenwald, D.H., M.C. Whitton et K. Maglaughlin, Évaluation d'un système de collaboration scientifique : étudier le potentiel d'un projet de collaboration avant le déploiement, dans Sciences sur Internet, A.Z.N.B. G. Olson, éditeur. 2006, MIT Press : Boston.

Sul, O.J., M.R. Falvo, R.M. Taylor II, S. Washburn et R. Superfine. Micro-dispositifs de locomotive à impact non attachés à action thermique. Appl. Phys. Lett.. 2006. 89(20) : p. 203512.

Wen, Q., C. Healey, M.C. Whitton et R.M. Taylor II. Une comparaison des performances de l'utilisateur dans un HMD immersif, un aquarium avec écrans haptiques pour la visualisation des données volumétriques. Actes de la perception appliquée dans les graphiques et la visualisation 2006. 2006 : p. 8 pages.

Borland, D., J. Clarke et R.M. Taylor II. Peeling de profondeur volumétrique pour l'arthroscopie virtuelle. Newsletter du Groupe Technique International SPIE. 2005. 16(2) : p. 1.

Burns, E., S. Razzaque, A.T. Panter, M.C. Whitton, M.R. McCallus et F.P. Brooks Jr. La main est plus lente que l'œil : une exploration quantitative de la dominance visuelle sur la proprioception. dans Actes de l'IEEE Virtual Reality 2005. Mention honorable au concours du meilleur article. 2005 : Société informatique IEEE.

Burns, E., S. Razzaque, M.C. Whitton, M.R. McCallus, A.T. Panter et F.P. Brooks Jr. La main est plus facilement dupe que l'œil : les utilisateurs sont plus sensibles à l'interpénétration visuelle qu'à la divergence visuo-proprioceptive. Présence : téléopérateurs et environnements virtuels. 2005.

Cribb, J., D.B. Hill, R.M. Taylor, L. Vicci, J. Fisher, K.V. Desai, B. Wilde, J. Sheehan, M.G. Forest et R. Superfine. Mesure des propriétés microrhéologiques locales du mucus humain avec des microbilles à entraînement magnétique. Journal biophysique. 2005. 88(1) : p. 505a-505a.

Fisher, J.K., J.R. Cummings, K.V. Desai, L. Vicci, B. Wilde, K. Keller, C. Weigle, G. Bishop, R.M. Taylor, C.W. Davis, R.C. Boucher, E.T. O’Brien et R. Superfine. Microscope à force tridimensionnel : Un système nanométrique de suivi optique et de manipulation magnétique pour les sciences biomédicales. Examen des instruments scientifiques. 2005. 76(5).

Hill, D.B., J. Cribb, H. Matsui et R. Superfine. Oscillations dans le flux de mucus. Journal biophysique. 2005. 88(1) : p. 505a-505a.

Hollins, M., F. Lorenz, A. Seeger et R. Taylor. Facteurs contribuant à l'intégration des qualités texturales : évidence des surfaces virtuelles. Somatosens Mot Res. 2005. 22(3) : p. 193-206.

Kohli, L., E. Burns, D. Miller et H. Fuchs. Combiner l'haptique passive avec la marche redirigée. dans la Conférence internationale de la réalité artificielle et de la téléexistence (ICAT) 2005. 2005. Christchurch, Nouvelle-Zélande.

Kohli, L. et M.C. Whitton. La main haptique : fournir des commentaires sur l'interface utilisateur avec la main non dominante dans les environnements virtuels. dans Actes de Graphics Interface 2005. 2005.

Marshburn, D., C. Weigle, B.G. Wilde, K. Desai, J.K. Fisher, J. Cribb, E.T. O'Brien, R. Superfine et R.M.T. II. L'interface logicielle avec le microscope 3D-Force. Actes de la visualisation IEEE. 2005 : p. 455-462.

Meehan, M., S. Razzaque, B. Insko, M. Whitton et F.P. Brooks, Jr. Examen de quatre études sur l'utilisation de la réaction physiologique comme mesure de la présence dans des environnements virtuels stressants. Appl Psychophysiol Biofeedback. 2005. 30(3) : p. 239-58.

Peng, L., R. Cubicciotti et M. Guthold. Nouvelle méthodologie à molécule unique pour identifier de nouveaux aptamères. Journal biophysique. 2005. 88(1) : p. 65A Partie 2 Suppl S.

Stadermann, M., S.J. Papadakis, M.R. Falvo, Q. Fu, J. Liu, Y. Fridman, J.J. Borland, R. Superfine et S. Washburn. Décroissance exponentielle de la conductance locale dans les nanotubes de carbone à paroi unique. Phys. Rév. B.. 2005. 72(24) : p. 245406.

Whitton, M.C., J. Cohn, J. Feasel, P. Zimmons, S. Razzaque, J. Poulton, B. McLeod et F.P. Brooks Jr. Comparaison des interfaces de locomotion VE. dans Actes de IEEE Virtual Reality 2005. 2005. Bonn, Allemagne : IEEE Computer Society.

Whitton, M.C., J. Cohn, J. Feasel, P. Zimmons, S. Razzaque, S. Poulton, B. McLeod et F.P. Brooks. Comparaison des interfaces de locomotion VE. dans Actes de IEEE Virtual Reality 2005. 2005.

Cohn, M.C. Whitton, W. Becker et F.P. Brooks, Présentation de l'information et performance d'impact de la méthode de contrôle sur une tâche de locomotion virtuelle complexe (résumé), dans Human Factors and Ergonomics Society. 2004 : La Nouvelle-Orléans, LO.

Dwyer, C., R.M. Taylor II, L. Vicci et J. Poulton. Architectures d'ordinateurs parallèles activées par l'auto-assemblage. Actes du 1er Colloque sur les Fondements des Nanosciences. 2004. 379.

Dwyer, C., L. Vicci, J. Poulton, D. Erie, R. Superfine, S. Washburn et R.M. Taylor II. La conception de circuits informatiques auto-assemblés ADN. IEEE Trans. sur VLSI. 2004. 12: p. 1214-20.

Dwyer, C., L. Vicci, J. Poulton et R.M. Taylor II. Architectures d'ordinateurs parallèles auto-assemblées d'ADN. Nanotechnologie. 2004. 15: p. 1688-94.

Guthold, M., Liu, W., Stephens, BJ, Lord, ST, Hantgan, RR, Erie, DA, Taylor, RM, Superfine, R. (2004) « La visualisation et les manipulations mécaniques des fibres de fibrine individuelles suggèrent que les fibres se croisent -La section a une dimension fractale 1,3" Biophys. J. 87, 4226-36

Guthold, M., W. Liu, B. Stephens, S.T. Lord, R.R. Hantgan, D.A. Érié, R.M. Taylor, Jr., et R. Superfine. La visualisation et les manipulations mécaniques des fibres de fibrine individuelles suggèrent que la section transversale des fibres a une dimension fractale 1.3. Biophys J. 2004. 87(6) : p. 4226-36. 15465869

Hollins, M., A. Seeger, G. Pelli et R. Taylor. Perception haptique des surfaces virtuelles : mise à l'échelle des qualités subjectives et des différences interstimulus. la perception. 2004. 33(8) : p. 1001-19. 15521697

Hudson, T., M.C. Whitton, A. Helser et D.H. Sonnenwald. Gestion de la collaboration dans le nanoManipulator. Présence. 2004. 13(2).

Jen, D., P. Parente, J. Robbins, C. Weigle, R.M. Taylor II, A. Burette et R. Weinberg. ImageSurfer : Un outil pour visualiser les corrélations entre deux champs scalaires de volume. dans IEEE Visualization 2004 Actes. 2004. Austin, Texas.

Jones, G., T. Tretter, A. Bokinski et A. Negishi. Technologie haptique et apprentissage. Haptique-e. 2004.

Jones, M.G., T. Andre, D. Kubasko, A. Bokinski, T. Tretter, A. Negishi, R.M. Taylor II et R. Superfine Hands-on Investigations avec des organismes microscopiques. Éducation scientifique. 2004.

Jones, M.G., T. Andre, D. Kubasko, A. Bokinski, T. Tretter, A. Negishi, R.M. Taylor II, et R. Superfine Microscopie à force atomique à distance d'organismes microscopiques : Innovations technologiques pour la science pratique avec les collégiens et les lycéens. Éducation scientifique. 2004. 88: p. 55-71.

Jones, M.G., J. Minogue, T. Tretter, A. Negishi et R.M. Taylor II. Augmentation haptique de l'enseignement des sciences : le toucher est-il important ? Éducation scientifique. 2004.

Jones, M.G., T. Tretter, M. Paechter, D. Kubasko et A. Bokinski. Spectateur ou participant ? Des étudiants afro-américains écrivent sur la science. Éducation scientifique. 2004.

Labbe, J.C., E.K. McCarthy et B. Goldstein. Les forces qui positionnent asymétriquement un fuseau mitotique sont attachées jusqu'après l'assemblage du fuseau. J Cell Biol. 2004. 167(2) : p. 245-56. 15492042

Lok, B., S. Naik, M.C. Whitton et F.P. Brooks Jr. Effets de la manipulation d'objets réels et de la fidélité à l'auto-avatar sur la performance des tâches cognitives et le sentiment de présence dans les environnements virtuels. Journal on Presence : téléopérateurs et environnements virtuels. 2004. 12(6) : p. 615-628.

Matthews, W.G., A. Negishi, D.M. McCarty, R.J. Samulski, R.M. Taylor II et R. Superfine Manipulation contrôlée d'assemblages macromoléculaires et de microsphères sur des surfaces – Démonstration de roulement à l'échelle nanométrique. Langmuir. 2004.

Negishi, A., J. Chen, D.M. McCarty, R.J. Samulski, J. Liu et R. Superfine. Analyse de l'interaction entre virus adéno-associé et héparane sulfate par microscopie à force atomique. Glycobiologie. 2004. 14(11) : p. 969-77. 15215232

Paechter, M., M.G. Jones, T. Tretter, A. Bokinski, D. Kubasko, A. Negishi et T. Andre. Enseignement scientifique pratique : concevoir un enseignement attrayant pour les étudiants et les étudiantes. 2004.

Peintre, J., M.G. Jones, D. Kubasko, T. Tretter, A. Negishi et T. Andre. Lever le rideau : des scientifiques en classe. Sciences et mathématiques scolaires. 2004.

Papadakis, S.J., A.R. Hall, PA Williams, L. Vicci, M.R. Falvo, R. Superfine et S. Washburn. Oscillateurs résonants avec ressorts de torsion en nanotubes de carbone. Lettres d'examen physique. 2004. 93: p. 146101.

Stadermann, M., S.J. Papadakis, M.R. Falvo, J. Novak, E. Snow, Q. Fu, J. Liu, Y. Fridman, J.J. Boland, R. Superfine et S. Washburn. Étude à l'échelle nanométrique de la conduction à travers des réseaux de nanotubes de carbone. Examen physique B. 2004. 69(20) : p. 201402.

Sul, O., S.J. Papadakis, M.R. Falvo, Y. Fridman, R.M. Taylor II, R. Superfine et S. Washburn. Actionneurs bimorphes à base de nanotubes de carbone : Cintrage thermique de cantilevers métal-nanotube. Appl. Phys. Lett.. 2004.

Taylor II, R.M., D. Borland, F.P. Brooks Jr., M. Falvo, M. Guthold, T. Hudson, K. Jeffay, G. Jones, D. Marshburn, S.J. Papadakis, L.-C. Qin, A. Seeger, F.D. Smith, D.H. Sonnenwald, R. Superfine, S. Washburn, C. Weigle, M.C. Whitton, P. Williams, L. Vicci et W. Robinett, Visualization and Natural Control Systems for Microscopy, in Manuel de visualisation, C.J.a.C. Hansen, éditeur. 2004, Harcourt Academic Press. p. 875-900.

Asokan, S.B., L.M. Jawerth, R.L. Carroll, R.E. Cheney, S. Washburn et R. Superfine Manipulation bidimensionnelle et orientation des systèmes actine-myosine avec diélectrophorèse. Nano lettres. 2003. 3(4) : p. 431-437.

Bokinsky, A. Data Driven Spots: A Layered Visualization Technique for the Interactive Display of Multiple 2D Scalar Variables, in Computer Science 2003, University of North Carolina: Chapel Hill

Brooks Jr., F.P., Avant-propos, dans Niveau de détail des graphiques 3D, D. Luebke, et al., éditeurs. 2003, Morgan Kaufmann Éditeurs : San Francisco, Californie. p. ix.

Brooks Jr., F.P. Incorporer des objets réels dynamiques dans des environnements virtuels immersifs. dans ACM SIGGRAPH. 2003. San Diego, Californie : Transactions ACM sur les graphiques.

Carter, G., M.G. Jones et M. Rua. Les effets de la capacité du partenaire sur la réussite et l'organisation conceptuelle des élèves de cinquième année les plus performants. Éducation scientifique. 2003. 87(1) : p. 94-111.

Christiansen, N. et K.L. Maglaughlin. Passage du lieu de travail physique à l'espace de travail virtuel : soyez vigilant. dans Conférence internationale sur l'interaction homme-machine. 2003.

Dwyer, C., R.M. Taylor II et L. Vicci. Simulation des performances de la logique de transistor à effet de champ à tige de silicium à l'échelle nanométrique. IEEE Trans. sur la nanotechnologie. 2003. 2(2) : p. 69-74.

Hall, A., G. Matthews, R. Superfine, M. Falvo et S. Washburn. Méthode simple et efficace pour la fixation de nanotubes de carbone aux sondes de balayage et autres substrats. Appl. Phys. Lett.. 2003. 82(15) : p. 2506-2508.

Hudson, T., A. Helser, D.H. Sonnenwald et M.C. Whitton. Gestion de la collaboration dans le nanomanipulateur distribué. dans IEEE Réalité Virtuelle 2003. 2003. Los Angeles, Californie : IEEE Press.

Hudson, T. Adapting Interactive Applications for Distributed Environments, in Computer Science 2003, UNC-CH : Chapel Hill

Jones, G., A. Bokinski, T. Tretter, A. Negishi, D. Kubasko, R. Superfine et R.M.Taylor II, Microscopie à force atomique avec le toucher : Applications pédagogiques, en Science, technologie et enseignement de la microscopie : un aperçu, A. Mendez-Vilas, éditeur. 2003, Formatex : Madrid, Espagne.

Jones, G., T. Andre, R. Superfine et R.M. Taylor II. Apprentissage à l'échelle nanométrique : l'impact de l'utilisation de la microscopie à distance par les étudiants sur les concepts de virus, d'échelle et de microscopie. Revue de recherche en enseignement des sciences. 2003. 40(3) : p. 303-322.

Jones, M.G., T. Hargrove et B. Jones. Les métaphores ratées de l'enseignement. L'administrateur de l'école. 2003. 60(11) : p. 26-28.

Lok, B., Evaluation and Application of Algorithms for a Hybrid Environment System, in Visualisation et manipulations mécaniques de fibres de fibrine individuelles, B. Thompson, rédacteur en chef. 2003, University of Rochester Press : New York. p. 149-175.

Lok, B., S. Naik, M.C. Whitton et F.P. Brooks Jr. Effets de la gestion d'objets réels et de la fidélité d'avatar sur les performances des tâches cognitives dans les environnements virtuels. dans IEEE Réalité Virtuelle 2003. 2003. Los Angeles, Californie.

Maglaughlin, K.L. Une exploration des facteurs de collaboration scientifique universitaire interdisciplinaire., dans School of Information and Library Science 2003, Université de Caroline du Nord à Chapel Hill :

Meehan, M., S. Razzaque, M.C. Whitton et F.P. Brooks Jr. Effet de la latence sur la présence dans des environnements virtuels stressants. dans IEEE Réalité Virtuelle 2003. 2003. Los Angeles, Californie.

Papadakis, S.J., P.A. Williams, O. Sul, M.R. Falvo, R. Superfine et S. Washburn. Mécanique des nanotubes et dispositifs à base de nanotubes. dans École d'hiver internationale sur les propriétés électroniques des nouveaux matériaux. 2003. Kirchberg, Autriche.

Prakash, R., S. Washburn, R. Superfine, R.E. Cheney et M. Falvo. Visualisation de nanotubes de carbone individuels par microscopie à fluorescence à l'aide de fluorophores conventionnels. Appl. Phys. Lett.. 2003. 83: p. 1219-1221.

Seeger, A., C. Fretzagias et R. Taylor, 2e. Techniques d'accélération logicielle pour la simulation d'images au microscope électronique à balayage. Balayage. 2003. 25(5) : p. 264-73. 14748390

Sonnenwald, D.H. Attentes d'un collaborateur scientifique : une étude de cas. dans ACM GROUP 2003 Conférence. 2003. NY : ACM Press.

Sonnenwald, D.H. et B. Li. Collaborateurs scientifiques dans l'enseignement supérieur : explorer les préférences de style d'apprentissage et les perceptions de la technologie. British Journal of Educational Technology. 2003. 43(3) : p. 419-431.

Sonnenwald, D.H., K.L. Maglaughlin et M.C. Whitton. Concevoir pour soutenir la conscience de la situation à distance : un exemple d'un collaborateur scientifique. Traitement de l'information et gestion de l'amp. 2003.

Sonnenwald, D.H., M.C. Whitton et K.L. Maglaughlin. Évaluation d'une collaboration scientifique : Résultats d'une expérience contrôlée. Transactions ACM sur l'interaction homme-ordinateur. 2003. 10(2) : p. 150-176.

Sonnenwald, D.H., M.C. Whitton et K.L. Maglaughlin. Collaborateurs scientifiques : évaluer leur potentiel. Interactions ACM. 2003. 19(4) : p. 9-10.

Stadermann, M. Buckling Nanotube avec carte de conductivité (Visualization Challenge). Science. 2003. 301: p. 1473.

Stadermann, M., H. Grube, J. Boland, S.J. Papadakis, M.R. Falvo, R. Superfine et S. Washburn. Mesure par microscopie à force atomique simultanée de la topographie et de la résistance de contact des films métalliques et des nanotubes de carbone. Examen des instruments scientifiques. 2003. 74(8) : p. 3653-3655.

Stilwell, J.L., D.M. McCarty, A. Negishi, R. Superfine et R.J. Samulski. Développement et caractérisation de nouvelles capsides d'adénovirus vides et leur impact sur l'expression des gènes cellulaires. J Virol. 2003. 77(23) : p. 12881-5. 14610209

Sul, O., S.J. Papadakis, M. Falvo, Y. Fridman, R.M. Taylor II, S. Washburn et R. Superfine Bimorph actionneurs à base de nanotubes de carbone : flexion thermique des porte-à-faux en métal-nanotube. Appl. Phys. Lett.. 2003.

Taylor II, R.M., C. Ware et V. Interrante. Conception de visualisation basée sur la perception. dans Notes de cours pour le cours SIGGRAPH 2003 #45, Cours d'une journée sur la visualisation organisé par R.M. Taylor II. 2003. San Diego, Californie.

Tretter, T. et G. Jones. Un sens de l'échelle : étudier comment l'échelle affecte les systèmes et les organismes. Professeur de sciences. 2003. 70(1) : p. 22-25.

Tretter, T. et M.G. Jones. Relations entre l'enseignement basé sur l'investigation et les résultats des tests standardisés en sciences physiques. Sciences et mathématiques scolaires. 2003. 103(7) : p. 345-350.

Wang, H., Y. Yang, M.J. Schofield, C. Du, Y. Fridman, S.D. Lee, E.D. Larson, J.T. Drummond, E. Alani, P. Hsieh et D.A. Érié. La flexion et la déflexion de l'ADN par MutS régissent la reconnaissance et la spécificité des mésappariements. Proc Natl Acad Sci U S A. 2003. 100(25) : p. 14822-7. 14634210

Whitton, M.C. Rendre les environnements virtuels attrayants. Communication de l'ACM. 2003.

Williams, P., S.J. Papadakis, A. Patel, M. Falvo, S. Washburn et R. Fabrication superfine de dispositifs mécaniques à l'échelle nanométrique incorporant des nanotubes de carbone individuels à parois multiples en tant que ressorts de torsion. Appl. Phys. Lett.. 2003. 82: p. 805.

Zhang, J., G.L. Wang, Y.S. Shon, O. Zhou, R. Superfine et R. Murray. Interactions de petites molécules et nanoparticules d'Au avec des nanotubes de carbone à simple paroi solubilisés. Journal de chimie physique B. 2003. 107(16) : p. 3726-3732.

Zimmons, P. The Influence of Lighting Quality on Presence and Task Performance in Virtual Environments, in Computer Science 2003, UNC-CH: Chapel Hill p.244

Brooks Jr., F.P., L'histoire du système d'exploitation IBM / 360, dans Pionniers du logiciel : contributions au génie logiciel, M. Broy et E. Denert, éditeurs. 2002, Springer : Berlin. p. 170-178.

Dwyer, C., R. Taylor et L. Vicci. Simulation de transport d'un transistor à effet de champ à tige de silicium à l'échelle nanométrique. dans IEEE 2e conférence sur la nanotechnologie. 2002. Arlington, Virginie.

Dwyer, C., M. Guthold, M. Falvo, S. Washburn, R. Superfine et D. Erie. Nanotubes de carbone monoparoi fonctionnalisés par ADN. Nanotechnologie. 2002. 13: p. 601-4.

Dwyer, C., R. Taylor et L. Vicci. Simulation en mode mixte de la logique de transistor à effet de champ à tige de silicium à l'échelle nanométrique. IEEE Trans. sur la nanotechnologie. 2002.

Harris, M.J., G. Coombe, T. Scheuermann et A. Lastra. Simulation visuelle basée sur la physique sur du matériel graphique. dans 2002 SIGGRAPH / Atelier Eurographics sur le matériel graphique. 2002. Sarrebruck, Allemagne.

Jones, M.G., T. Andre, D. Kubasko, A. Bokinsky, T. Tretter, A. Negishi, R. Taylor et R. Superfine. Enquêtes pratiques avec des organismes microscopiques. Éducation scientifique. 2002.

Lok, Colombie-Britannique Interagir avec des objets réels dynamiques dans des environnements virtuels, dans Computer Science 2002, Université de Caroline du Nord : Chapel Hill p.172

Maglaughlin, K.L. et D.H. Sonnenwald. Perspectives des utilisateurs sur les critères de pertinence : une comparaison entre des jugements pertinents, partiellement pertinents et non pertinents. Journal de la Société américaine de l'information et de la technologie. 2002. 53(5) : p. 327-342.

Meehan, M., B. Insko, M. Whitton et F.P. Brooks Jr. Mesures physiologiques de la présence dans des environnements virtuels stressants. Transactions ACM sur les graphiques. 2002. 21(3) : p. 645-652.

Mortensen, J., V. Vinayagamoorthy, M. Slater, A. Steed, B. Lok et M.C. Whitton. Collaboration dans des environnements télé-immersifs. dans Huitième atelier Eurographics sur les environnements virtuels. 2002. Barcelone, Espagne : ACM – L'association Eurographics.

Razzaque, S., D. Swapp, M. Slater, M.C. Whitton et A. Steed. Marcher sur place redirigé. dans Huitième atelier Eurographics sur les environnements virtuels. 2002. Barcelone, Espagne : ACM – L'association Eurographics.

Sonnenwald, D.H., M.C. Whitton et K.L. Maglaughlin. Collaborateurs scientifiques. Bulletin ASIS&T. 2002. 28(6).

Superfine, R., M. Falvo, R.M. Taylor II et S. Washburn, Nanomanipulation: Buckling, Transport and Rolling at the Nanoscale, in Manuel du CRC sur les nanosciences, l'ingénierie et la technologie, S. Lyshevski, et al., éditeurs. 2002, CRC Press LLC : Boca Raton.

Superfine, R., G. Bishop, J. Cummings, J. Fisher, K. Keller, G. Matthews, D. Sill, R.M. Taylor II, L. Vicci, C. Weigle, G. Welch et B. Wilde. Toucher dans les systèmes biologiques : un microscope à force 3D. dans Microscopie et Microanalyse 2002. 2002. Ville de Québec, Canada.

Taylor II, R.M. Visualisation de plusieurs champs sur la même surface. Infographie IEEE et applications. 2002 (mars-avril) : p. 6-10.

Varadhan, G., W. Robinett, D. Erie et R.M. Taylor II. Simulation rapide de l'imagerie au microscope à force atomique de surfaces atomiques et polygonales à l'aide de matériel graphique. dans Conférence SPIE sur la visualisation et l'analyse de données. 2002. Centre des congrès de San José, San José, Californie.

Washburn, S. et S.J. Papadakis. Transport à travers des interfaces alignées atomiquement : Manipulation du bout des doigts et sondage électrique de nanotubes. dans Atelier international sur les interférences électroniques et la décohérence dans les nanostructures. 2002. Institut Max Planck de physique des systèmes complexes.

Williams, P.A., S.J. Papadakis, M.R. Falvo, A.M. Patel, M. Sinclair, A. Seeger, A. Helser, R.M. Taylor II, S. Washburn et R. Superfine. Placement contrôlé d'un nanotube de carbone individuel sur une structure microélectromécanique. Lettres de physique appliquée. 2002. 80(14) : p. 2574-2576.

Williams, P.A., S.J. Papadakis, A.M. Patel, M.R. Falvo, S. Washburn et R. Superfine. Réponse en torsion et rigidification de nanotubes de carbone multiparois individuels. Phys Rev Lett. 2002. 89(25) : p. 255502. 12484895

Brooks Jr., F.P. L'histoire du système d'exploitation IBM/360. dans Conférence des pionniers du logiciel SD&M. 2001. Bonn, Allemagne.

Guthold, M. et D.A. Érié. L'étude d'une molécule unique révèle une ARN polymérase complexe d'E. coli. Chembiochem. 2001. 2(3) : p. 167-70. 11828441

Guthold, M., R. Superfine et R.M. Taylor II. Les règles changent : les mesures de force sur des molécules individuelles et leur relation avec la cinétique et les énergies de réaction en vrac. Microdispositifs biomédicaux. 2001. 3(1) : p. 9-18.

Harris, M. et A. Lastra. Rendu Cloud en temps réel. Forum d'infographie. 2001. 20(3) : p. 76-84.

Hudson, T.C., M.C. Weigle, K. Jeffay et R.M. Taylor II. Expériences de mise en réseau multimédia optimale pour un environnement virtuel distribué. Actes de l'informatique multimédia et des réseaux. 2001 (janvier) : p. 88-98.

Insko, B. Passive Haptics améliore considérablement les environnements virtuels, dans Computer Science 2001, Université de Caroline du Nord : Chapel Hill

Jeffay, K., T. Hudson et M. Parris. Au-delà de l'audio et de la vidéo : prise en charge de la mise en réseau multimédia pour un environnement virtuel immersif et distribué. dans 27ème Conférence EUROMICRO. 2001. Varsovie, Pologne.

Lindholm, E., M.J. Kligard et H. Moreton. Un moteur de vertex programmable par l'utilisateur. dans Conférence internationale sur l'infographie et les techniques interactives. 2001 : Presse ACM.

Lok, B. Reconstruction de modèle en ligne pour les environnements virtuels interactifs. dans Symposium ACM sur les graphiques 3D interactifs. 2001.

Meehan, M., B. Insko, M.C. Whitton et F.P. Brooks. Mesures physiologiques de la présence dans les environnements virtuels. dans 4ème Atelier International sur la Présence. 2001. Philadelphie.

Meehan, M. Physiological Reaction as an Objective Measure of Presence in Virtual Environments, in Computer Science 2001, University of North Carolina: Chapel Hill p.142

Razzaque, S., Z. Kohn et M.C. Whitton. Marche redirigée. dans Eurographie 2001. 2001.

Seeger, A., S. Paulson, M. Falvo, A. Helser, R.M. Taylor, R. Superfine et S. Washburn. Qu'est-ce que ça fait de rouler une molécule ? dans 45e conférence internationale sur la technologie des faisceaux d'électrons, d'ions et de photons et la nanofabrication. 2001.

Seeger, A., S. Paulson, M. Falvo, A. Helser, R.M. Taylor II, R. Superfine et S. Washburn. Outils pratiques pour la nanotechnologie. Journal of Vacuum Science & Technology. 2001. B19: p. 2717-2722.

Sonnenwald, D.H., R.E. Bergquist, K.L. Maglaughlin, E. Kupstas-Soo et M.C. Whitton, Concevoir pour soutenir la recherche scientifique collaborative à distance : l'environnement nanoManipulator, dans Environnements virtuels collaboratifs, E. Churchill, D. Snowdon et A. Munro, éditeurs. 2001, Springer Verlag : Londres. p. 202-224.

Sonnenwald, D.H., K.L. Maglaughlin et M.C. Whitton. Utilisation de la théorie de la diffusion de l'innovation pour guider l'évaluation des technologies de collaboration : travail en cours. dans 10e atelier international de l'IEEE sur les technologies habilitantes pour les entreprises collaboratives (WETICE). 2001. NY : IEEE Press.

Taylor II, R.M., T.C. Hudson, A. Seeger, H. Weber, J. Juliano et A.T. Helser. VRPN : un système périphérique VR indépendant du périphérique et transparent au réseau. dans Symposium ACM sur les logiciels de réalité virtuelle et la technologie amp 2001. 2001. Banff Centre, Canada.

Arthur, K. Effects of Field of View on Performance with Head-Mounted Displays, in Computer Science 2000, University of North Carolina : Chapel Hill

Brooks Jr., F.P. La conception de la conception. dans Adresse du prix Turing au SIGGRAPH 󈧄. 2000 : Communication de l'ACM.

Christiansen, M., K. Jeffay, D. Ott et F.D. Forgeron. Réglage du RED pour le trafic Web. dans ACM SIGCOMM. 2000. Stockholm, Suède.

Falvo, M.R., J. Steele, R.M.T. II, et R. Superfine. Mouvement de roulement semblable à un engrenage médié par un contact proportionné : nanotubes de carbone sur HOPG. Phys. Rév. B. 2000. 62(15 octobre) : p. 10665-10667.

Falvo, M.R., J. Steele, R.M.T. II, et R. Superfine. Preuve d'un contact et d'un mouvement de roulement proportionnés : études de manipulation AFM de nanotubes de carbone sur HOPG. Lettres de tribologie. 2000. 9: p. 73-76.

Falvo, M.R. et R. Superfine. Mécanique et frottement à l'échelle nanométrique. Journal de recherche sur les nanoparticules. 2000. 2: p. 237-248.

Gregory, A., M.C. Lin, S. Gottschalk et R.M.T. II. Détection de collision en temps réel pour une interaction haptique à l'aide d'un dispositif de retour de force 3-DoF. Géométrie computationnelle : théorie et applications (numéro spécial sur les environnements virtuels). 2000. 15(1-3) : p. 69-89.

Guthold, M., M.R. Falvo, W.G. Matthews, S. Paulson, S. Washburn, D. Erie, R. Superfine, F.P. Brooks et R.M. Taylor. Manipulation contrôlée d'échantillons moléculaires avec le nanoManipulator. Transactions IEEE/ASME sur la mécatronique. 2000. 5(2) : p. 189-198.

Guthold, M., J. Mullin, S. Lord, D. Erie, R. Superfine et R. Taylor. Manipulation contrôlée de molécules de fibrine individuelles. Biophys. J.. 2000. 78: p. A53.

Paulson, S., A. Helser, M.B. Nardelli, R.M.T. II, M. Falvo, R. Superfine et S. Washburn. Résistance accordable d'une interface nanotube de carbone-graphite. Science. 2000. 290(décembre) : p. 1742-1744.

Rivetti, C., M. Guthold et C. Bustamante, enveloppement d'ADN dans des complexes de promoteurs ouverts d'ARN polymérase d'E. coli révélés par microscopie à force de balayage, dans Interactions protéine-ADN : une approche pratique, A. Travers et M. Buckle, éditeurs. 2000, Oxford University Press : Oxford.

Seeger, A., A. Henderson, G.L. Pelli, M. Hollins et R.M.T. II. Affichage haptique de plusieurs champs scalaires sur une surface. dans Atelier sur les nouveaux paradigmes dans la visualisation et la manipulation de l'information. 2000. Washington, D.C. : ACM Press.

Sincell, M. NanoManipulator permet aux chimistes d'aller Mano a Mano avec des molécules. Science. 2000. 290(24 novembre) : p. 1530.

Superfin, R., G. Jones et R.M. Taylor II. Toucher les virus dans un projet de sensibilisation en microscopie en réseau. dans Conférence sur la sensibilisation K-12 des départements de sciences universitaires. 2000. Université d'État de Caroline du Nord : Science House.

Taylor II, R.M. Exemples pratiques de visualisation scientifique. Infographie. 2000. 34(1) : p. 74-79 et couverture.

Weigle, C., W.G. Emigh, G. Liu, R.M. Taylor, J.T. Enns et C.G. Healey. Éclats de texture orientés : une technique d'estimation de la valeur locale de plusieurs champs scalaires. dans Interface graphique. 2000. Montréal, Canada.

Bastos, R., K. Hoff, W. Wynn et A. Lastra. Photoréalisme accru pour les procédures architecturales interactives. dans Actes du Symposium de 1999 sur les graphiques 3D interactifs. 1999.

Brooks Jr., F.P. Qu'est-ce qui est réel à propos de la réalité virtuelle ? Infographie IEEE et applications. 1999. 19 (6)(nov./déc.) : p. 16-27.

Bustamante, C., M. Guthold, X. Zhu et G. Yang. Emplacement de la cible facilité sur l'ADN par des molécules individuelles d'ARN polymérase d'Escherichia coli observées avec le microscope à balayage fonctionnant dans un liquide. J Biol Chem. 1999. 274(24) : p. 16665-8. 10358002

Clark, M. et K. Jeffay. Mesures des performances au niveau de l'application sur le vBNS. dans Conférence internationale IEEE sur l'informatique et les systèmes multimédias. 1999. Florence, Italie.

Falvo, M.R., G. Clary, A. Helser, S. Paulson, R.M. Taylor II, V. Chi, F.P. Brooks Jr., S. Washburn et R. Superfine. Expériences de nanomanipulation explorant les propriétés frictionnelles et mécaniques des nanotubes de carbone. Microscopie et microanalyse. 1999. 4: p. 504-512.

Falvo, M.R., R.M. Taylor, 2e, A. Helser, V. Chi, F.P. Brooks, Jr., S. Washburn et R. Superfine. Roulage et glissement à l'échelle nanométrique de nanotubes de carbone. La nature. 1999. 397(6716): p. 236-8. 9930698

Gregory, A., M.C. Lin, S. Gottschalk et R. Taylor. H-COLLIDE : Un cadre pour une détection de collision rapide et précise pour une interaction haptique. dans Actes de VR 󈨧. 1999. Houston, Texas.

Guthold, M., M. Falvo, W.G. Matthews, S. Paulson, J. Mullin, S. Lord, D. Erie, S. Washburn, R. Superfine, F.P. Brooks, Jr., et R.M. Taylor, 2e. Investigation et modification de structures moléculaires avec le nanoManipulator. Modèle graphique J Mol. 1999. 17(3-4) : p. 187-97. 10736776

Guthold, M., M.R. Falvo, W.G. Matthews, S. Paulson, S. Washburn, D. Erie, R. Superfine, J.F.P. Brooks et R.M.T. II. Manipulation contrôlée d'échantillons moléculaires avec le nanoManipulator. 1999.

Guthold, M., G. Matthews, A. Negishi, R.M. Taylor II, D. Erie, F.P. Brooks Jr. et R. Superfine. Manipulation quantitative de l'ADN et des virus avec le nanoManipulator Scanning Force Microscope. Le surf. Interf. Une analyse. 1999. 27: p. 437-443.

Guthold, M., X. Zhu, C. Rivetti, G. Yang, N.H. Thomson, S. Kasas, H.G. Hansma, B. Smith, P.K. Hansma et C. Bustamante. Observation directe de la diffusion et de la transcription unidimensionnelles par l'ARN polymérase d'Escherichia coli. Biophys J. 1999. 77(4) : p. 2284-94. 10512846

Jeffay, K. Vers un service de transfert meilleur que le meilleur pour les flux multimédias. IEEE Multimédia. 1999. 6(4 (octobre-décembre)) : p. 84-88.

Jones, G.M., R. Superfine et R.M.T. II. Virus virtuels. Professeur de sciences. 1999. 66(7) : p. 48-50.

Matthews, W.G., A. Negishi, A. Seeger, R. Taylor, D.M. McCarty, R.J. Samulski et R. Superfine. Elasticité et liaison de l'adénovirus dans l'air et dans le liquide. 43e réunion annuelle de la Biophysical Society, du 13 au 17 février 1999, Baltimore, MD Biophys.J.. 1999. A27.

Negishi, A., W.G. Matthews, D.M. McCarty, R.J. Samulski, D. Rohrer, A. Henderson, R. Taylor et R. Superfine. Sonder les propriétés structurelles de l'adénovirus à l'aide du microscope à force atomique. 43e réunion annuelle de la Biophysical Society, du 13 au 17 février 1999, Baltimore, MD Biophys. J.. 1999. 76: p. A27.

Paulson, S., M.R. Falvo, N. Snider, A. Helser, T. Hudson, A. Seeger, R.M. Taylor, R. Superfine et S. Washburn. Mesures de résistance in situ de nanotubes de carbone tendus. Lettres de physique appliquée. 1999. 75(19) : p. 2936-2938.

Rivetti, C., M. Guthold et C. Bustamante. Enroulement de l'ADN autour du complexe promoteur ouvert de l'ARN polymérase d'E.coli. Embo J. 1999. 18(16) : p. 4464-75. 10449412

Sonnenwald, D.H., E. Kupstas Soo et R. Superfine Une évaluation multidimensionnelle du nanoManipulator, un système de collaboration scientifique. Bulletin SIGGROUP ACM. 1999. 20(2) : p. 46-50.

Taylor II, R.M. et R. Superfine, Advanced Interfaces to Scanned-Probe Microscopes, dans Manuel des matériaux nanostructurés et de la nanotechnologie, H.S. Nalwa, éditeur. 1999, Academic Press : New York. p. 271-308.

Taylor II, R.M. Applications scientifiques du retour de force : simulation moléculaire et contrôle au microscope. dans SIGGRAPH 󈨧. 1999. Los Angeles, Californie.

Usoh, M., K. Arthur, M.C. Whitton, R. Bastos, A. Steed, M. Slater et F.P. Brooks. Marcher > marcher sur place > voler dans des environnements virtuels. dans Proc. de SIGGRAPH 󈨧, Actes d'infographie, Série de conférences annuelles. 1999.

Arthur, K., T. Preston, R. Taylor, F.P.B. Jr., M.C. Whitton et W.V. Wright. Le PIT : conception, mise en œuvre et prochaines étapes. dans 2e atelier international sur les technologies de projection immersive. 1998. Ames, Iowa.

Grant, B., A. Helser et R.M. Taylor II. Ajout de l'affichage de la force à un affichage de projection stéréoscopique avec suivi de la tête. dans VRAIS 󈨦. 1998. Atlanta, Géorgie.

Ratcliff, G.C., D.A. Erie et R. Superfine. Oscillation photothermique pour la microscopie à force atomique en mode oscillant en solution. Appl. Phys. Lett.. 1998. 72(15) : p. 1911-1913.

Robinett, W. Basculement entre les quatre modes d'un système de téléopérateur : téléopération, simulation, relecture et robot. dans Conférence internationale sur la réalité artificielle et la télé-existence. 1998. Tokyo, Japon.

Matériaux et méthodes

Allèles mutants

Détection histochimique de l'activité β-galactosidase et coloration des anticorps

La coloration histochimique a été réalisée sur des boyaux disséqués à la main selon Murakami et al. (1994). La coloration des anticorps des embryons a été réalisée par des méthodes standards avec des anticorps anti-Ultrabithorax et anti-labial (Panganiban et al. 1990), ou le tag anti-myc monoclonal 9E10 (Oncogene Research Products) au 1:500, suivi d'un rehaussement avec le Vectastain Trousse d'élite ABC. Les embryons colorés et les intestins disséqués ont été photographiés avec un microscope Zeiss Axiophot et les images numérisées avec un Nikon Coolscan, ou ont été photographiées avec un appareil photo numérique Spot sur un microscope Leica DMR. Les images numériques ont été assemblées avec Adobe Photoshop 4.0 et étiquetées avec FreeHand 8.0 sur un Power Macintosh.

Construction de gènes codant Torso/βcytprotéines de fusion

Les UAS–torse WT /βcytgène a été construit en combinant, dans une série d'étapes, les cinq fragments d'ADN suivants : (1) un KpnJE-CelluleII (rempli) fragment de pUAST (Brand et Perrimon 1993) contenant le promoteur UAS et 36 nucléotides de HSP70 5' séquence non traduite (2) un XhoJe (remplis) pour SspFragment BI de pBD490 (B. Dickson et E. Hafen, comm. pers.) contenant une séquence signal suivie d'une étiquette myc et de l'extrémité aminée du domaine extracellulaire Torso (3) un SspBI-ÉcoFragment RI (rempli) detorseWT–sev (Dickson et al. 1992) contenant le reste du domaine extracellulaire Torso et le domaine transmembranaire (4) unBamHI (garni avec de la nucléase de haricot mungo) pour SpéI fragment de pβcyt (voir ci-dessous) contenant le domaine cytoplasmique de l'intégrine βPS sous-unité (5) aSpéJE-RsrFragment II contenant le site de polyadénylation du rosé gène (Martin-Bermudo et al. 1997). Le gène a été cloné entre Kpnmoi et RsrII sites dans un vecteur d'élément P contenant le blanche comme marqueur sélectionnable (pWhiteRabbit, N.H. Brown non publié). Le plasmide pβcyt, qui contient un BamSite HI à la jonction entre les domaines transmembranaire et cytoplasmique duPS sous-unité, a été généré par PCR, avec l'amorce GGAGGATCCTCACTACGATCCAC et une amorce dans le vecteur, cloné comme un BamSALUT-PasJe fragmente et vérifie par séquençage (le SpéLe site I utilisé pour le fragment 4 se trouve dans la région 3' non traduite du??PS gène). Les séquences d'acides aminés aux jonctions entre les domaines transmembranaire et cytoplasmique sont -LLLWKLLTTIHDRR- dans lePS sous-unité et -LTFC RILTTIHDRR- dans le torse WT /βcyt fusion (la séquence Torso est soulignée et les acides aminés de jonction RI proviennent de la synthèse Écosite de l'IR). Pour générer leUAS–torse D /βcytgène, un ONGMI-ÉcoFragment RI deUAS–torse WT /βcyta été remplacé par le fragment correspondant detorse4021–sev (Dickson et al. 1992). Les transformants d'éléments P ont été obtenus par des méthodes standard, et plusieurs lignées ont été obtenues pour chaque construction. Des lignées indépendantes des constructions ont été utilisées les lignées B, E2 et D1 pour la UAS–torse WT /βcytgène et lignées B et C pour leUAS–torse D /βcytgène. Ils ont été exprimés dans l'intestin moyen par la lignée GAL4 48A, qui s'exprime dans l'intestin moyen à partir du stade 12 (Martin-Bermudo et al. 1997). Pour distinguer sans ambiguïté les miauler embryons mutants, nous avons utilisé un chromosome équilibreur marqué avec jaune + (Martin-Bermudo et al. 1997), par exemple, les femelles vierges ouais M6 /FM6, ouais + UAS–torse D /βcyt ont été croisés àoui + /Oui 24B 258 mâles. Dans la progéniture, tous exprimeront UAS–torse D /βcytsous le contrôle de 48Y et contenir les 258 piège amplificateur, et les 1/4 qui sont mutants pour miauler peuvent être distingués par leuroui crochets buccaux.

Pour évaluer le rôle des sous-unités , nous avons utilisé les constructions UAS suivantes : UAS–PS1 2.1, UAS–PS1/2cyt 2.1, UAS–PS2/1cyt 2.A, UAS–PS2 2A (Martin-Bermudo et al. 1997) .

Biologie des tumeurs (10/13)

-Protéger les extrémités ouvertes des chromosomes de la recombinaison, de la fusion de bout en bout et de la reconnaissance en tant qu'ADN endommagé
-Permet la réplication complète de l'ADN
-S'associer les uns aux autres pour réguler la transcription, faciliter l'appariement des chromosomes frères à la mitose et ancrer les chromosomes aux membranes nucléaires

Auto-renouvellement (peut former deux cellules filles avec une ou les deux conservant les mêmes propriétés biologiques que la cellule mère)

Maintien à long terme de la tumeur

Cela conduit à une augmentation de l'absorption du glucose (parce qu'il est moins efficace) en raison du changement des isozymes

La tumeur précoce se dilate --> dépasse les limites de diffusion de l'apport sanguin local --> hypoxie --> stabilisation du HIF

Adipocytes - augmentation de la migration des cellules tumorales, invasion en régulant l'expression et l'activation des MMP, adipokines pro-inflammatoires

CE - recrutement de leucocytes et comportement et métastase des cellules tumorales, forment des vaisseaux angiogéniques, expression de MMP et de TIMP pour influencer la progression tumorale

Péricytes - stabilisent les vaisseaux sanguins, inhibent la prolifération des CE, maintiennent le diamètre des capillaires, régulent le flux sanguin, fournissent des signaux de survie des CE via des contacts hétérotypiques et des facteurs solubles

DCs - induisent la vascularisation, l'immunopathogenèse tumorale, les fonctions pro et anti-tumorales

Macrophages - régulation immunitaire, croissance cellulaire et développement tumoral

Cellules immunitaires - croissance et progression via les TAM et les cellules suppressives dérivées de myéloïdes et leurs cytokines (IL-23, IL-6, IL-1B et TNF-a)

Activation de l'intégrine et réarrangement structurel

Adresses des auteurs Junichi Takagi, Timothy A. Springer, Centre de recherche sur le sang, Départements de pathologie et de pédiatrie, Harvard Medical School, Boston, Massachusetts, États-Unis.

Adresses des auteurs Junichi Takagi, Timothy A. Springer, The Center for Blood Research, Départements de pathologie et de pédiatrie, Harvard Medical School, Boston, Massachusetts, États-Unis.

Adresses des auteurs Junichi Takagi, Timothy A. Springer, The Center for Blood Research, Départements de pathologie et de pédiatrie, Harvard Medical School, Boston, Massachusetts, États-Unis.

Adresses des auteurs Junichi Takagi, Timothy A. Springer, Centre de recherche sur le sang, Départements de pathologie et de pédiatrie, Harvard Medical School, Boston, Massachusetts, États-Unis.

Junichi Takagi Timothy A. Springer


Sommaire: Parmi les familles de récepteurs d'adhésion, les intégrines sont particulièrement importantes dans les processus biologiques qui nécessitent une modulation rapide de l'adhésion et de la désadhésion. L'activation sur une échelle de temps de < 1 s des intégrines 2 sur les leucocytes et des intégrines β3 sur les plaquettes permet le dépôt de ces cellules aux sites d'inflammation ou de lésion de la paroi vasculaire. Les structures récentes de cristal, de résonance magnétique nucléaire (RMN) et de microscope électronique (EM) des intégrines et de leurs domaines conduisent à un mécanisme d'activation unificateur pour les intégrines qui contiennent et celles qui n'ont pas de domaine (I) inséré. Le domaine I adopte deux conformations alternatives, appelées ouverte et fermée. En similitude frappante avec la signalisation des protéines G, le réarrangement d'un site de liaison au Mg 2+ est lié à de grands mouvements de conformation dans des régions distantes du squelette. Les mutations qui stabilisent une conformation particulière montrent que la conformation ouverte a une affinité élevée pour le ligand, alors que la conformation fermée a une faible affinité. Le mouvement de l'hélice C-terminale 10 Å sur le côté du domaine dans la conformation ouverte est suffisant pour augmenter l'affinité au niveau du site de liaison du ligand distal de 9000 fois. Cette "corde en cloche" C-terminale fournit un mécanisme de liaison aux mouvements conformationnels dans d'autres domaines. Des structures et des études fonctionnelles récentes révèlent des interactions entre les domaines β-propeller, I et I-like dans la tête de l'intégrine, et un rôle critique pour les domaines du facteur de croissance épidermique (EGF) de l'intégrine dans la région de la tige. La tête de l'intégrine est tournée vers la membrane dans la conformation inactive et s'étend vers le haut dans une ouverture en forme de « lame de commutation » lors de l'activation. Ces réarrangements structurels à longue distance de la molécule d'intégrine entière impliquant des contacts interdomaines semblent étroitement liés aux changements de conformation dans les domaines I et I-like, qui entraînent une affinité et une compétence accrues pour la liaison de ligand.


Dosage MTT

Les concentrations d'EGF et les durées de traitement étaient basées sur des études antérieures avec des lignées cellulaires de cancer du côlon. Plus précisément, les cellules HCT116 ont été traitées avec 1, 10 ou 100 ng/mL d'EGF pendant 5, 30 min, 1, 12, 24 ou 48 h, et la prolifération a été évaluée par le test MTT. Ces analyses ont révélé que la prolifération des cellules HCT116 augmentait progressivement de manière dépendante de la concentration et du temps (Fig. 1).

Modifications des cellules HCT116 traitées par EGF. La concentration optimale d'EGF pour les expériences futures a été fixée à 100 ng/mL, et le temps d'exposition optimal à l'EGF a été fixé à 24 et 48 h principalement (CTL contrôler)

Altérations de l'expression de l'intégrine 1 et Rab25 suite à une exposition à l'EGF

Les cellules HCT116 ont été exposées à 100 ng/mL d'EGF pendant 24 h, et l'expression de l'intégrine 1 et Rab25 a été contrôlée par western blot (Fig. 2). Notamment, l'expression de l'intégrine 1 a augmenté au fil du temps en réponse à la stimulation de l'EGF, atteignant un pic à 16 h et diminuant par la suite par rapport au contrôle de la β-actine (p < 0.05 Fig. 2a, b). Un résultat similaire a été trouvé pour l'expression de Rab25, qui a également augmenté en réponse au traitement par EGF (p < 0,05 Fig. 2a, c). Fait intéressant, une exposition prolongée à l'EGF pendant 48 h a entraîné une diminution significative de l'expression de l'intégrine 1 par rapport aux niveaux de base (p = 0,026 Fig. 3).

Expression de l'intégrine β1 et de Rab25 dans les cellules traitées par EGF. une L'expression de l'intégrine 1 et de Rab25 a été examinée dans des cellules HCT116 stimulées avec 100 ng/mL d'EGF par western blot. b, c Quantification densitométrique des données présentées dans une pour b intégrine β1 et c Rab25 (CTL contrôler)

Expression de l'intégrine β1 après stimulation par EGF pendant 48 h. une L'expression de l'intégrine 1 après stimulation avec 100 ng/mL d'EGF a été contrôlée par western blot. b Quantification densitométrique des données présentées dans une (p = 0,026)

Effets du traitement par EGF sur le trafic et la sécrétion de l'intégrine β1

Pour déterminer si la stimulation de l'EGF modifiait la localisation de l'intégrine 1, les cellules HCT116 ont été traitées avec 100 ng/mL d'EGF, puis soumises à un fractionnement subcellulaire et à une analyse par transfert western. Ces résultats ont démontré que l'intégrine β1 était presque exclusivement localisée dans la fraction membranaire, et son expression diminuait progressivement en réponse au traitement par EGF à 24 et 48 h (p = 0,026 Fig. 4a). Comme l'intégrine β1 n'a pas été détectée dans la fraction cytosolique, nous avons effectué des analyses ELISA avec des milieux de culture collectés après 48 h d'exposition à 100 ng/mL d'EGF. En conséquence, nous avons trouvé une augmentation des niveaux d'intégrine β1 de 0,451 ng/mL dans les cultures non traitées à 0,616 ng/mL après 48 h de traitement EGF (Fig. 4b). Les changements relatifs de la localisation de l'intégrine 1 dans le cytosol, la membrane et les surnageants de culture sont illustrés à la figure 4c.

Analyse de la localisation et de l'excrétion de l'intégrine β1. une La localisation de l'intégrine 1 dans la membrane et le cytosol a été examinée par fractionnement subcellulaire et western blot. b L'excrétion de l'intégrine 1 a été contrôlée par ELISA après stimulation avec EGF pendant 48 h. c Les changements dépendants de l'EGF dans la localisation subcellulaire de l'intégrine 1 ont été examinés par quantification densitométrique des données présentées dans une

Effets respectifs de l'expression de Rab25 et de la stimulation de l'EGF sur l'expression et le trafic de l'intégrine 1

Nous avons ensuite cherché à déterminer si l'expression de l'intégrine 1 était régulée par Rab25. Pour cela, nous avons transfecté des cellules de cancer du côlon HCT116 avec un siARN spécifique de Rab25 et confirmé une précipitation suffisante par western blot (Fig. 5a). Une analyse ultérieure des niveaux d'intégrine 1 a révélé une diminution significative après le knockdown de Rab25 (p = 0,003 Fig. 5b). De plus, le fractionnement membranaire/cytosolique a démontré que bien que l'intégrine 1 soit encore indétectable dans le cytoplasme, une augmentation marquée s'est produite dans la fraction membranaire après 24 h de traitement par EGF (p = 0,001) (Fig. 5c).

Altérations de la localisation de l'intégrine 1 après le knockdown de Rab25. une L'expression de l'intégrine 1 et de Rab25 a été contrôlée par western blot après fractionnement. b Quantification densitométrique de l'expression de l'intégrine 1 dans des cellules simulées et Rab25-knockdown. c Quantification densitométrique des données présentées dans une (CTL contrôler)

Une analyse densitométrique supplémentaire a été effectuée pour déterminer les effets de la stimulation de l'EGF et de l'expression de Rab25 sur la localisation de l'intégrine 1. Notamment, les faibles niveaux d'intégrine β1 dans le cytosol ont été encore réduits en réponse à l'exposition à l'EGF (p = 0,045), alors qu'un effet opposé a été observé dans les cellules knockdown Rab25 traitées à l'EGF (p = 0,011 Fig. 6a). De plus, la stimulation par l'EGF a diminué les niveaux d'intégrine 1 membranaire dans les cellules témoins (p < 0,001), cependant, cela a été inversé dans les cellules knockdown Rab25, où les niveaux d'intégrine β1 dans la membrane ont augmenté après le traitement par EGF (p = 0,001) (Fig. 6b).

Modifications de l'expression de l'intégrine β1 en réponse à la stimulation de l'EGF et à la suppression de Rab25. une, b Distribution relative de l'intégrine β1 dans une cytosol et b membrane après stimulation EGF en contrôle (CTL cellules de contrôle, trait plein) et Rab25-knockdown (siRab25, trait pointillé)


Cette revue a exploré la nature opposée de β2 les fonctions pro- et anti-inflammatoires de l'intégrine dans trois fonctions immunitaires principales, ce qui en fait des candidats de choix pour être à la fois d'importants médiateurs et régulateurs du système immunitaire. Le premier est la migration, qui permet un recrutement ciblé des cellules immunitaires vers les sites d'infection et les lésions tissulaires. La seconde est l'adhésion, non seulement précédant l'extravasation des cellules immunitaires aux sites d'inflammation, mais également un facteur important dans l'initiation de la réponse immunitaire adaptative en facilitant les interactions cellulaires. Enfin, la signalisation des cellules immunitaires, qui permet une coopération affinée entre une grande variété de cellules immunitaires. Considérant le fait que β2 Les intégrines jouent un rôle complexe dans trois domaines importants du système immunitaire et leur expression différentielle sur les monocytes, les macrophages et les CD, il devient clair que la variété des études présentées dans cette revue n'est en aucun cas exhaustive. Le message commun est évident : β2 les intégrines sont impliquées dans des voies de signalisation immunorégulatrices complexes. Cependant, en plus de leurs rôles pro-inflammatoires bien établis dans le recrutement et l'activation, β2 les intégrines ont également des fonctions immunorégulatrices essentielles. La signalisation, l'expression et l'activation de surface des intégrines dérégulées sont donc susceptibles de contribuer à une variété de conditions inflammatoires et auto-immunes. Élucider la fonction de β2 les intégrines promettent donc en outre de fournir de nouvelles cibles thérapeutiques pour divers troubles, la PR n'étant qu'un exemple.


Dans l'ensemble, les RCPG participent à tous les aspects de la biologie des cellules souches épidermiques, en maintenant l'identité des cellules souches épithéliales adultes, en coordonnant les interactions des cellules souches avec leur niche et en intégrant des signaux extrinsèques pour aider les cellules souches à s'adapter aux changements environnementaux. Alors que nous nous sommes efforcés de lier les effets des GPCR et des ligands à la régulation des cellules souches, il est évident que des modèles plus spécifiques dans lesquels les GPCR sont inactivés ou surexprimés dans des compartiments de cellules souches particuliers sont nécessaires pour disséquer la contribution des récepteurs au destin des cellules souches. Une analyse unicellulaire plus sensible qui détecte les gènes faiblement exprimés améliorerait considérablement notre compréhension du pool de GPCR exprimés dans chaque compartiment de cellules souches épidermiques. Des progrès supplémentaires sont également nécessaires dans la validation de modèles murins sur la biologie de la peau humaine en raison des différences de structure de la peau, de modulateurs immunitaires et de gènes GPCR spécifiques à chaque espèce.

Bien que dans cette revue nous nous concentrions sur les rôles des GPCR non sensoriels, il a été démontré que les kératinocytes expriment des récepteurs sensoriels comme les opsines activées par la lumière. 112 De plus, de nombreux nutriments et métabolites microbiens activent les GPCR, 113 indiquant que cette famille de récepteurs peut fonctionner comme un lien entre le régime alimentaire, le microbiome et les cellules souches somatiques.Le rôle précis des GPCR dans la transduction d'indices lumineux, alimentaires et microbiotiques pour coordonner le destin des cellules souches épithéliales est un domaine passionnant et sous-exploré. Un autre aspect fascinant de la signalisation GPCR est son rôle dans la régulation de la suppression et de la promotion des tumeurs. De nombreux GPCR et protéines G hétérotrimériques sont mutés dans le cancer et l'AMPc joue un rôle de premier plan dans la modulation des voies qui se croisent avec la progression tumorale, notamment les prostaglandines, la signalisation Hedgehog et Hippo. Des recherches supplémentaires sur les GPCR spécifiques, les partenaires de signalisation et les cellules impliquées aideront à concevoir des stratégies thérapeutiques ciblant les voies intrinsèques de souche associées à la transformation maligne et à la croissance tumorale.

Enfin, bien que les signaux GPCR soient transitoires et que de nombreuses voies soient activées simultanément pour désensibiliser les récepteurs et mettre fin aux cascades intracellulaires, ces signaux transitoires ont des effets durables sur le devenir des cellules souches épithéliales. Une meilleure compréhension de la façon dont la signalisation GPCR interagit avec la régulation transcriptionnelle et épigénétique fournira des informations importantes sur les mécanismes impliqués dans le maintien de l'identité des cellules souches et les approches utilisées par les cellules souches pour répondre et s'adapter aux changements microenvironnementaux.

Voir la vidéo: Intermediate filaments: structure,classification and function (Février 2023).