Informations

Comment une protéine atteint-elle son substrat dans la cellule ?

Comment une protéine atteint-elle son substrat dans la cellule ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Une fois qu'une protéine a été synthétisée et que le tertiaire/quaternaire final a été adopté, comment atteint-elle son substrat dans la cellule et qu'est-ce qui la fait interagir avec elle ?

Les facteurs de transcription pour un gène particulier sont des protéines qui sont traduites à partir de gènes sur une autre partie de l'ADN. (Cela se passe dans le cytoplasme) Mais comment les facteurs de transcription savent-ils qu'il doit se diffuser dans la région de l'ADN du noyau.


La protéine ne va vers rien. Il diffuse juste au hasard (rebondit) dans la cellule jusqu'à ce qu'il colle à quelque chose. La structure chimique particulière (la forme) de la protéine et tout ce qu'elle frappe déterminera à quel point elles se collent et si une réaction chimique se produit ou non.

Une façon d'imaginer cela est de penser à un pot rempli de beaucoup de billes de verre (eau), 1 aimant en forme de bille (la protéine) et 1 bille de métal (le substrat). Placez l'aimant en bas, remplissez le pot au maximum de billes de verre, puis placez la bille de métal sur le dessus. Fermez ensuite le bocal et secouez-le. Finalement, après être entré en collision avec de nombreuses billes de verre, l'aimant et la bille de métal entreront en collision et se colleront l'un à l'autre. C'est aussi comme ça que ça marche dans les cellules. Dans les cellules, la vitesse à laquelle les molécules se déplacent est proportionnelle à la température.

Voici une vidéo sympa qui montre comment des protéines avec une forme très spécifique rebondissant au hasard peuvent s'assembler en une structure complexe.

Pour avoir une idée de la vitesse à laquelle les molécules se déplacent dans une cellule, pensez à une cellule bactérienne. Un E. coli la cellule mesure environ 1 micromètre de diamètre. Dans une cellule de cette taille sans compartiments sous-cellulaires, chaque molécule entrera en collision avec chaque autre molécule de la cellule environ une fois par seconde (si nous faisons certaines hypothèses telles que l'absence de liaison à d'autres molécules). Ainsi, si la cellule ne contient qu'une unité d'une certaine enzyme et qu'une seule molécule de son substrat, elles entreront toujours en collision assez fréquemment (environ une fois par seconde).

Ce taux diminue considérablement à mesure que le rayon de la cellule augmente. Par exemple, une cellule avec le double du diamètre (2 micromètres) a un volume huit fois plus grand, donc les collisions entre deux molécules prennent 8 fois (2^3$) plus de temps pour se produire (en d'autres termes, il faut 8 fois plus de temps aux molécules pour "se trouver" l'un l'autre). C'est l'une des raisons pour lesquelles il existe une sorte de limite supérieure à la taille d'une cellule individuelle. Les organismes plus gros sont plus gros parce qu'ils ont plus de cellules, pas parce qu'ils ont des cellules plus grosses.

Le domaine de la biologie concerné par la probabilité qu'une réaction se produise s'appelle la cinétique enzymatique. Un domaine connexe, qui traite de la fréquence à laquelle les molécules entrent en collision s'appelle la mécanique statistique.


Livraison de substrats ubiquitinés à des machines de dépliage de protéines

Des travaux récents ont montré que l'ubiquitination conduit à la reconnaissance de protéines cibles par divers récepteurs d'ubiquitine. Une famille de récepteurs délivre les protéines ubiquitinées au protéasome, ce qui entraîne un dépliement et une protéolyse du substrat dépendant de l'ATP. Une famille apparentée de protéines de liaison à l'ubiquitine semble recruter des protéines ubiquitinées pour Cdc48, un complexe annulaire d'ATPase qui peut également déplier des protéines. Certaines cibles semblent s'arrimer à Cdc48 avant le protéasome, dans une voie ordonnée. L'interaction intime entre le protéasome et Cdc48, médiée en partie par des récepteurs d'ubiquitine faiblement associés, a des fonctions importantes dans la régulation cellulaire.


Introduction

On pense généralement que les protéines sont transportées à travers un canal conducteur de protéines de la membrane du RE dans une conformation dépliée. Dans la translocation cotraductionnelle, un état déplié est maintenu simplement par le fait que la chaîne polypeptidique naissante est transportée tout en étant synthétisée sur un ribosome qui est lié au canal membranaire. En revanche, pour les protéines transportées post-traductionnellement, il doit y avoir un mécanisme qui empêche leur agrégation ou leur repliement prématuré dans une structure stable avant qu'elles ne soient transportées à travers le canal. Les chaperons cytosoliques sont probablement impliqués pour maintenir un substrat de translocation dans une conformation dépliée ou faiblement pliée avant qu'il n'entre dans le canal (Chirico et al. 1988 Deshaies et al. 1988 Zimmermann et al. 1988 Caplan et al. 1992 Chirico 1992). Cependant, l'identité des chaperons et le mécanisme par lequel ils fonctionnent restent largement inconnus. De plus, une fois liés au substrat, les chaperons et autres protéines cytosoliques en interaction sembleraient poser un problème pour l'étape de translocation ultérieure. Comment sont-ils libérés pour permettre à la chaîne polypeptidique de glisser à travers le canal ? Une possibilité est qu'il existe un mécanisme actif par lequel ils sont libérés lorsque le substrat se lie ou se déplace à travers le canal. Alternativement, la libération peut se produire spontanément dans le cytosol, et le canal membranaire peut uniquement capturer des chaînes polypeptidiques libres.

La translocation post-traductionnelle se produit à la fois dans la levure et dans les cellules de mammifères, bien que dans ce dernier cas, seuls les substrats inférieurs à 70 acides aminés soient transloqués et que le mécanisme de transport ne soit pas bien compris (Zimmermann et al. 1988). Des études chez la levure ont montré que le canal de translocation post-traductionnelle est formé à partir d'un complexe protéique membranaire à sept composants, le complexe Sec (Panzner et al. 1995). Le complexe Sec se lie au substrat de translocation par sa séquence signal. Ce dernier s'intercale dans deux domaines transmembranaires de la sous-unité Sec61p du complexe, entraînant l'insertion de la chaîne polypeptidique dans le canal sous forme de boucle (Plath et al. 1998). Le mouvement ultérieur de la chaîne à travers le canal implique la fonction de la lumière Kar2p (également appelée BiP), un membre de la famille des protéines de choc thermique de 70 kD (Hsp70) dans la lumière du RE (Vogel et al. 1990 Brodsky et Schekman 1993). Au moins dans le cas du facteur prépro-α du substrat de translocation (ppαF, 165 acides aminés), Kar2p peut fonctionner comme un cliquet moléculaire pour déplacer la chaîne polypeptidique à travers la membrane (Matlack et al. 1999). Il se lie à la chaîne polypeptidique entrante et empêche son retour à travers le canal.

Les chaperons cytosoliques impliqués dans la translocation post-traductionnelle des protéines incluent Hsp70 et son cofacteur, la protéine J Ydj1p (Chirico et al. 1988 Deshaies et al. 1988 Zimmermann et al. 1988 Caplan et al. 1992 Becker et al. 1996). Des expériences dans Saccharomyces cerevisiae ont montré que des mutants à perte de fonction dans les gènes correspondants affectent la translocation de certaines protéines (Deshaies et al. 1988 Caplan et al. 1992 Becker et al. 1996). De plus, des expériences biochimiques ont fourni des preuves que Hsp70 peut s'associer au substrat ppαF et peut stimuler sa translocation post-traductionnelle in vitro (Chirico et al. 1988 Chirico 1992). On ne sait pas si les chaperons autres que le système Hsp70-Ydj1p interagissent avec les substrats de translocation post-traductionnelle. De manière significative, cependant, les protéines cytosoliques ne sont pas nécessaires pour le processus de translocation en soi. L'exigence de liaison et de libération de facteurs cytosoliques peut être contournée en dénaturant le substrat dans l'urée, et le processus de translocation peut être reconstitué avec des composants purifiés en l'absence de toute protéine cytosolique (Chirico et al. 1988 Matlack et al. 1999). De plus, le système Hsp70-Ydj1p est requis pour la translocation dans le RE et les mitochondries. Ainsi, il est possible que les chaperons cytosoliques ne conservent que les polypeptides dans une conformation faiblement repliée et n'aient aucune interaction spécifique avec les signaux de ciblage ou la machinerie de translocation dans la membrane.

Bien qu'il soit concevable qu'un substrat de translocation post-traductionnelle interagisse avec les mêmes chaperons cytosoliques qu'une chaîne polypeptidique restant dans le cytosol, certaines différences peuvent exister. Pour les polypeptides dépourvus de séquences signal, Hsp70 et Hsp40 (une protéine J cytosolique de mammifère) s'associent à des chaînes naissantes liées au ribosome (Frydman et al. 1994 Frydman et Hartl 1996 Eggers et al. 1997 Pfund et al. 1998). En outre, il a été rapporté que le complexe polypeptide 1 (TCP1) du complexe sans queue contenant des chaperonines (TRiC/CCT pour examen, voir Kim et al. 1994) interagit avec les chaînes naissantes liées au ribosome (Frydman et al. 1994 Frydman et Hartl 1996 McCallum et al. 2000), contrairement à l'homologue bactérien GroEL, qui ne lie que les polypeptides complets (Netzer et Hartl 1998). Les chaînes polypeptidiques liées au ribosome, mais pas de pleine longueur, interagissent également avec le complexe naissant associé aux polypeptides (NAC) (Wiedmann et al. 1994). Bien qu'aucune étude systématique sur l'interaction avec les protéines cytosoliques n'ait été réalisée pour les substrats de translocation post-traductionnelle, la situation peut être assez différente. Au cours de la synthèse de la chaîne polypeptidique, la séquence signal interagit probablement avec la particule de reconnaissance du signal (SRP), bien que l'interaction puisse être plus faible qu'avec les séquences signal plus hydrophobes qui dirigent les substrats dans la voie de translocation cotraductionnelle (Ng et al. 1996). Ainsi, la SRP peut bloquer l'association d'autres protéines cytosoliques avec la chaîne polypeptidique, en particulier tant qu'elle est encore liée au ribosome. De plus, il est possible qu'il existe des protéines cytosoliques qui, bien que non essentielles pour la translocation, reconnaissent spécifiquement la séquence signal et remplacent à un moment donné la SRP. Indépendamment du fait que les partenaires d'interaction cytosolique soient les mêmes pour les polypeptides avec et sans séquences signal, il existe le problème spécifique de la façon dont les protéines cytosoliques sont libérées pendant la translocation post-traductionnelle des protéines.

Ici, nous avons utilisé une approche systématique de photo-réticulation pour sonder les interactions des protéines cytosoliques avec des substrats de translocation au cours des premières étapes de leur translocation post-traductionnelle chez la levure, jusqu'à leur liaison au complexe Sec. Nos résultats indiquent qu'un substrat post-traductionnel synthétisé dans le système de lysat de réticulocytes interagit avec SRP et NAC tant qu'il est associé au ribosome. Après la fin de la traduction, il interagit avec plusieurs chaperons cytosoliques, dont Hsp70 et TRiC/CCT, et a donc probablement les mêmes partenaires d'interaction qu'un polypeptide dépourvu de séquence signal. En fait, aucun récepteur cytosolique spécifique pour les séquences signal des substrats post-traductionnels n'a pu être détecté. La libération des protéines cytosoliques du substrat de translocation se produit spontanément et le complexe Sec ne joue aucun rôle actif. Une fois liée au complexe Sec, la chaîne polypeptidique n'est associée à aucune protéine cytosolique, ce qui explique comment sa translocation ultérieure à travers le canal membranaire peut se produire sans interférence des protéines cytosoliques.


Biologie 171

À la fin de cette section, vous serez en mesure d'effectuer les opérations suivantes :

  • Décrire le rôle des enzymes dans les voies métaboliques
  • Expliquer comment les enzymes fonctionnent comme catalyseurs moléculaires
  • Discuter de la régulation enzymatique par divers facteurs

Une substance qui aide une réaction chimique à se produire est un catalyseur, et les molécules spéciales qui catalysent les réactions biochimiques sont des enzymes. Presque toutes les enzymes sont des protéines, composées de chaînes d'acides aminés, et elles effectuent la tâche critique d'abaisser les énergies d'activation des réactions chimiques à l'intérieur de la cellule. Les enzymes le font en se liant aux molécules réactives et en les retenant de manière à faciliter les processus de rupture et de formation de liaisons chimiques. Il est important de se rappeler que les enzymes ne modifient pas la réaction G. En d'autres termes, ils ne changent pas si une réaction est exergonique (spontanée) ou endergonique. C'est parce qu'ils ne modifient pas l'énergie libre des réactifs ou des produits. Ils ne font que réduire l'énergie d'activation nécessaire pour atteindre l'état de transition ((Figure)).


Site actif enzymatique et spécificité du substrat

Les réactifs chimiques auxquels une enzyme se lie sont les substrats de l'enzyme. Il peut y avoir un ou plusieurs substrats, selon la réaction chimique particulière. Dans certaines réactions, un substrat à réactif unique se décompose en plusieurs produits. Dans d'autres, deux substrats peuvent se réunir pour créer une molécule plus grosse. Deux réactifs peuvent également entrer dans une réaction, tous deux se modifient et quittent la réaction sous forme de deux produits. L'emplacement dans l'enzyme où le substrat se lie est le site actif de l'enzyme. C'est là que "l'action" se produit. Étant donné que les enzymes sont des protéines, il existe une combinaison unique de résidus d'acides aminés (également des chaînes latérales ou des groupes R) au sein du site actif. Différentes propriétés caractérisent chaque résidu. Ceux-ci peuvent être grands ou petits, faiblement acides ou basiques, hydrophiles ou hydrophobes, chargés positivement ou négativement, ou neutres. La combinaison unique de résidus d'acides aminés, de leurs positions, séquences, structures et propriétés, crée un environnement chimique très spécifique au sein du site actif. Cet environnement spécifique est adapté pour se lier, même brièvement, à un ou plusieurs substrats chimiques spécifiques. En raison de cette correspondance ressemblant à un puzzle entre une enzyme et ses substrats (qui s'adapte pour trouver la meilleure correspondance entre l'état de transition et le site actif), les enzymes sont connues pour leur spécificité. Le « meilleur ajustement » résulte de la forme et de l'attraction du groupe fonctionnel d'acides aminés sur le substrat. Il existe une enzyme spécifiquement adaptée à chaque substrat et, par conséquent, pour chaque réaction chimique, il existe également une flexibilité.

Le fait que les sites actifs soient si parfaitement adaptés pour fournir des conditions environnementales spécifiques signifie également qu'ils sont soumis à des influences environnementales locales. Il est vrai que l'augmentation de la température ambiante augmente généralement les vitesses de réaction, catalysées par des enzymes ou non. Cependant, l'augmentation ou la diminution de la température en dehors d'une plage optimale peut affecter les liaisons chimiques au sein du site actif de telle manière qu'elles sont moins bien adaptées pour lier les substrats. Des températures élevées finiront par provoquer la dénaturation des enzymes, comme d'autres molécules biologiques, un processus qui modifie les propriétés naturelles de la substance. De même, le pH de l'environnement local peut également affecter la fonction enzymatique. Les résidus d'acides aminés du site actif ont leurs propres propriétés acides ou basiques qui sont optimales pour la catalyse. Ces résidus sont sensibles aux changements de pH qui peuvent altérer la façon dont les molécules de substrat se lient. Les enzymes sont adaptées pour fonctionner au mieux dans une certaine plage de pH et, comme pour la température, des valeurs de pH environnementales extrêmes (acides ou basiques) peuvent entraîner la dénaturation des enzymes.

Ajustement induit et fonction enzymatique

Pendant de nombreuses années, les scientifiques ont pensé que la liaison enzyme-substrat s'effectuait d'une manière simple « verrou et clé ». Ce modèle affirmait que l'enzyme et le substrat s'assemblaient parfaitement en une seule étape instantanée. Cependant, la recherche actuelle soutient une vision plus raffinée que les scientifiques appellent l'ajustement induit ((Figure)). Ce modèle élargit le modèle de verrouillage et de clé en décrivant une interaction plus dynamique entre l'enzyme et le substrat. Au fur et à mesure que l'enzyme et le substrat se rejoignent, leur interaction provoque un léger changement dans la structure de l'enzyme qui confirme un arrangement de liaison idéal entre l'enzyme et l'état de transition du substrat. Cette liaison idéale maximise la capacité de l'enzyme à catalyser sa réaction.

Lorsqu'une enzyme se lie à son substrat, elle forme un complexe enzyme-substrat. Ce complexe abaisse l'énergie d'activation de la réaction et favorise sa progression rapide de plusieurs manières. À un niveau basique, les enzymes favorisent les réactions chimiques qui impliquent plus d'un substrat en rassemblant les substrats dans une orientation optimale. La région appropriée (atomes et liaisons) d'une molécule est juxtaposée à la région appropriée de l'autre molécule avec laquelle elle doit réagir. Une autre manière dont les enzymes favorisent la réaction du substrat consiste à créer un environnement optimal au sein du site actif pour que la réaction se produise. Certaines réactions chimiques peuvent mieux se dérouler dans un environnement légèrement acide ou non polaire. Les propriétés chimiques qui émergent de l'arrangement particulier des résidus d'acides aminés au sein d'un site actif créent l'environnement parfait pour que les substrats spécifiques d'une enzyme réagissent.

Vous avez appris que l'énergie d'activation requise pour de nombreuses réactions comprend l'énergie impliquée dans la manipulation ou la légère contorsion des liaisons chimiques afin qu'elles puissent facilement se briser et permettre aux autres de se reformer. L'action enzymatique peut aider ce processus. Le complexe enzyme-substrat peut abaisser l'énergie d'activation en contorsionnant les molécules du substrat de manière à faciliter la rupture des liaisons, aidant à atteindre l'état de transition. Enfin, les enzymes peuvent également abaisser les énergies d'activation en participant à la réaction chimique elle-même. Les résidus d'acides aminés peuvent fournir certains ions ou groupes chimiques qui forment en fait des liaisons covalentes avec des molécules de substrat en tant qu'étape nécessaire du processus de réaction. Dans ces cas, il est important de se rappeler que l'enzyme reviendra toujours à son état d'origine à la fin de la réaction. L'une des propriétés distinctives des enzymes est qu'elles restent finalement inchangées par les réactions qu'elles catalysent. Après qu'une enzyme catalyse une réaction, elle libère son ou ses produits.


Contrôle du métabolisme par la régulation enzymatique

Il semblerait idéal d'avoir un scénario dans lequel toutes les enzymes codées dans le génome d'un organisme existent en abondance et fonctionnent de manière optimale dans toutes les conditions cellulaires, dans toutes les cellules, à tout moment. En réalité, c'est loin d'être le cas. Divers mécanismes garantissent que cela ne se produise pas. Les besoins et les conditions cellulaires varient d'une cellule à l'autre et changent au sein des cellules individuelles au fil du temps. Les enzymes requises et les demandes énergétiques des cellules de l'estomac sont différentes de celles des cellules de stockage des graisses, des cellules de la peau, des cellules sanguines et des cellules nerveuses. De plus, une cellule digestive travaille beaucoup plus dur pour traiter et décomposer les nutriments pendant le temps qui suit de près un repas par rapport à plusieurs heures après un repas. Comme ces exigences et conditions cellulaires varient, les quantités et la fonctionnalité des différentes enzymes varient également.

Étant donné que les vitesses des réactions biochimiques sont contrôlées par l'énergie d'activation et que les enzymes diminuent et déterminent les énergies d'activation pour les réactions chimiques, les quantités relatives et le fonctionnement de la variété d'enzymes dans une cellule déterminent en fin de compte quelles réactions se dérouleront et à quelles vitesses. Cette détermination est étroitement contrôlée. Dans certains environnements cellulaires, des facteurs environnementaux comme le pH et la température contrôlent en partie l'activité enzymatique.Il existe d'autres mécanismes par lesquels les cellules contrôlent l'activité enzymatique et déterminent les vitesses auxquelles diverses réactions biochimiques se produiront.

Régulation moléculaire des enzymes

Les enzymes peuvent être régulées de manière à favoriser ou à réduire leur activité. Il existe de nombreux types de molécules qui inhibent ou favorisent la fonction enzymatique, et divers mécanismes existent pour le faire. Par exemple, dans certains cas d'inhibition enzymatique, une molécule inhibitrice est suffisamment similaire à un substrat pour qu'elle puisse se lier au site actif et simplement bloquer la liaison du substrat. Lorsque cela se produit, l'enzyme est inhibée par inhibition compétitive, car une molécule inhibitrice entre en compétition avec le substrat pour la liaison au site actif ((Figure)). Alternativement, dans l'inhibition non compétitive, une molécule inhibitrice se lie à l'enzyme dans un emplacement autre qu'un site allostérique, un site de liaison éloigné du site actif, et parvient toujours à bloquer la liaison du substrat au site actif.


Certaines molécules inhibitrices se lient aux enzymes à un endroit où leur liaison induit un changement de conformation qui réduit l'affinité de l'enzyme pour son substrat. Ce type d'inhibition est une inhibition allostérique ((Figure)). Plus d'un polypeptide comprend la plupart des enzymes régulées allostériquement, ce qui signifie qu'elles ont plus d'une sous-unité protéique. Lorsqu'un inhibiteur allostérique se lie à une enzyme, tous les sites actifs sur les sous-unités protéiques changent légèrement de sorte qu'ils se lient à leurs substrats avec moins d'efficacité. Il existe des activateurs allostériques ainsi que des inhibiteurs. Les activateurs allostériques se lient à des emplacements sur une enzyme éloignés du site actif, induisant un changement de conformation qui augmente l'affinité du ou des sites actifs de l'enzyme pour son ou ses substrats.



Découverte de médicaments en recherchant des inhibiteurs d'enzymes clés dans des voies spécifiques Les enzymes sont des composants clés des voies métaboliques. Comprendre comment les enzymes fonctionnent et comment elles peuvent être régulées est un principe clé derrière le développement de nombreux médicaments pharmaceutiques ((Figure)) sur le marché aujourd'hui. Les biologistes travaillant dans ce domaine collaborent avec d'autres scientifiques, généralement des chimistes, pour concevoir des médicaments.

Prenons l'exemple des statines, une classe de médicaments qui réduisent le taux de cholestérol. Ces composés sont essentiellement des inhibiteurs de l'enzyme HMG-CoA réductase. L'HMG-CoA réductase est l'enzyme qui synthétise le cholestérol à partir des lipides dans le corps. En inhibant cette enzyme, le médicament réduit le taux de cholestérol synthétisé dans l'organisme. De même, l'acétaminophène, communément commercialisé sous le nom de marque Tylenol, est un inhibiteur de l'enzyme cyclooxygénase. Bien qu'il soit efficace pour soulager la fièvre et l'inflammation (douleur), les scientifiques ne comprennent toujours pas complètement son mécanisme d'action.

Comment les médicaments sont-ils développés ? L'un des premiers défis du développement de médicaments consiste à identifier la molécule spécifique que le médicament est destiné à cibler. Dans le cas des statines, la HMG-CoA réductase est la cible du médicament. Les chercheurs identifient les cibles grâce à des recherches minutieuses en laboratoire. L'identification de la cible seule n'est pas suffisante. Les scientifiques doivent également savoir comment la cible agit à l'intérieur de la cellule et quelles réactions tournent mal en cas de maladie. Une fois que les chercheurs ont identifié la cible et la voie, le processus de conception du médicament commence. Au cours de cette étape, les chimistes et les biologistes travaillent ensemble pour concevoir et synthétiser des molécules qui peuvent bloquer ou activer une réaction particulière. Cependant, ce n'est que le début : à la fois si et quand un prototype de médicament réussit à remplir sa fonction, alors il doit subir de nombreux tests de in vitro des expériences aux essais cliniques avant d'obtenir l'approbation de la FDA pour être sur le marché.

De nombreuses enzymes ne fonctionnent pas de manière optimale, voire pas du tout, à moins qu'elles ne soient liées à d'autres molécules auxiliaires non protéiques spécifiques, soit temporairement par des liaisons ioniques ou hydrogène, soit de manière permanente par des liaisons covalentes plus fortes. Deux types de molécules auxiliaires sont les cofacteurs et les coenzymes. La liaison à ces molécules favorise une conformation et une fonction optimales de leurs enzymes respectives. Les cofacteurs sont des ions inorganiques tels que le fer (Fe++) et le magnésium (Mg++). Un exemple d'enzyme qui nécessite un ion métallique comme cofacteur est l'enzyme qui construit des molécules d'ADN, l'ADN polymérase, qui nécessite un ion zinc lié (Zn++) pour fonctionner. Les coenzymes sont des molécules auxiliaires organiques, avec une structure atomique de base composée de carbone et d'hydrogène, qui sont nécessaires à l'action enzymatique. Les sources les plus courantes de coenzymes sont les vitamines alimentaires ((Figure)). Certaines vitamines sont des précurseurs de coenzymes et d'autres agissent directement comme coenzymes. La vitamine C est une coenzyme pour plusieurs enzymes qui participent à la construction du composant important du tissu conjonctif, le collagène. Une étape importante dans la décomposition du glucose pour produire de l'énergie est la catalyse par un complexe multi-enzymatique que les scientifiques appellent la pyruvate déshydrogénase. La pyruvate déshydrogénase est un complexe de plusieurs enzymes qui nécessite en fait un cofacteur (un ion magnésium) et cinq coenzymes organiques différentes pour catalyser sa réaction chimique spécifique. Par conséquent, la fonction enzymatique est, en partie, régulée par une abondance de divers cofacteurs et coenzymes, que le régime alimentaire de la plupart des organismes fournit.


Compartimentation enzymatique

Dans les cellules eucaryotes, les molécules telles que les enzymes sont généralement compartimentées en différents organites. Cela permet encore un autre niveau de régulation de l'activité enzymatique. Les enzymes nécessaires uniquement pour certains processus cellulaires sont parfois logées séparément avec leurs substrats, ce qui permet des réactions chimiques plus efficaces. Des exemples de ce type de régulation enzymatique basée sur l'emplacement et la proximité incluent les enzymes impliquées dans les dernières étapes de la respiration cellulaire, qui ont lieu exclusivement dans les mitochondries, et les enzymes impliquées dans la digestion des débris cellulaires et des matières étrangères, situées dans les lysosomes.

Inhibition de la rétroaction dans les voies métaboliques

Les molécules peuvent réguler la fonction enzymatique de plusieurs manières. Cependant, une question majeure demeure : quelles sont ces molécules et d'où viennent-elles ? Certains sont des cofacteurs et des coenzymes, des ions et des molécules organiques, comme vous l'avez appris. Quelles autres molécules dans la cellule assurent la régulation enzymatique, telle que la modulation allostérique et l'inhibition compétitive et non compétitive ? La réponse est qu'une grande variété de molécules peut remplir ces rôles. Certains comprennent les médicaments pharmaceutiques et non pharmaceutiques, les toxines et les poisons de l'environnement. Les sources les plus pertinentes de molécules régulatrices d'enzymes, en ce qui concerne le métabolisme cellulaire, sont peut-être les produits de réaction métabolique cellulaire eux-mêmes. De la manière la plus efficace et la plus élégante, les cellules ont évolué pour utiliser leurs propres produits de réaction pour la rétro-inhibition de l'activité enzymatique. L'inhibition de la rétroaction implique l'utilisation d'un produit de réaction pour réguler sa propre production ultérieure ((Figure)). La cellule répond à l'abondance de produits spécifiques en ralentissant la production lors de réactions anaboliques ou cataboliques. De tels produits de réaction peuvent inhiber les enzymes qui ont catalysé leur production par les mécanismes que nous avons décrits ci-dessus.


La production d'acides aminés et de nucléotides est contrôlée par rétro-inhibition. De plus, l'ATP est un régulateur allostérique de certaines des enzymes impliquées dans la dégradation catabolique du sucre, le processus qui produit l'ATP. De cette façon, lorsque l'ATP est abondant, la cellule peut empêcher sa production ultérieure. N'oubliez pas que l'ATP est une molécule instable qui peut se dissocier spontanément en ADP. Si trop d'ATP était présent dans une cellule, une grande partie serait gaspillée. Alternativement, l'ADP sert de régulateur allostérique positif (un activateur allostérique) pour certaines des mêmes enzymes que l'ATP inhibe. Ainsi, lorsque les niveaux relatifs d'ATP sont élevés par rapport à l'ATP, la cellule est déclenchée pour produire plus d'ATP par le catabolisme du sucre.

Résumé de la section

Les enzymes sont des catalyseurs chimiques qui accélèrent les réactions chimiques à des températures physiologiques en abaissant leur énergie d'activation. Les enzymes sont généralement des protéines constituées d'une ou plusieurs chaînes polypeptidiques. Les enzymes ont un site actif qui fournit un environnement chimique unique, composé de certains groupes R d'acides aminés (résidus). Cet environnement unique est parfaitement adapté pour convertir des réactifs chimiques particuliers pour cette enzyme, les scientifiques appellent des substrats, en intermédiaires instables qu'ils appellent des états de transition. Les enzymes et les substrats se lient avec un ajustement induit, ce qui signifie que les enzymes subissent de légers ajustements de conformation au contact du substrat, conduisant à une liaison complète et optimale. Les enzymes se lient aux substrats et catalysent les réactions de quatre manières différentes : en rapprochant les substrats dans une orientation optimale, en compromettant les structures de liaison des substrats afin que les liaisons puissent se rompre plus facilement, en fournissant des conditions environnementales optimales pour qu'une réaction se produise ou en participant directement à leur réaction chimique en formant des liaisons covalentes transitoires avec les substrats.

L'action enzymatique doit être régulée de sorte que dans une cellule donnée à un moment donné, les réactions souhaitées se catalysent et les réactions indésirables ne le soient pas. Les enzymes sont régulées par des conditions cellulaires, telles que la température et le pH. Ils sont également régulés par leur localisation au sein d'une cellule, parfois compartimentés de sorte qu'ils ne peuvent catalyser des réactions que dans certaines circonstances. L'inhibition et l'activation enzymatiques via d'autres molécules sont d'autres moyens importants de réguler les enzymes. Les inhibiteurs peuvent agir de manière compétitive, non compétitive ou allostérique. Les inhibiteurs non compétitifs sont généralement allostériques. Les activateurs peuvent également améliorer la fonction enzymatique de manière allostérique. La méthode la plus courante par laquelle les cellules régulent les enzymes dans les voies métaboliques est la rétro-inhibition. Au cours de la rétro-inhibition, les produits de la voie métabolique servent d'inhibiteurs (généralement allostériques) d'une ou plusieurs des enzymes (généralement la première enzyme engagée de la voie) impliquées dans la voie qui les produit.

Réponse libre

Concernant les enzymes, pourquoi les vitamines sont-elles nécessaires à une bonne santé ? Donne des exemples.

La plupart des vitamines et des minéraux agissent comme des coenzymes et des cofacteurs pour l'action enzymatique. De nombreuses enzymes nécessitent la liaison de certains cofacteurs ou coenzymes pour pouvoir catalyser leurs réactions. Étant donné que les enzymes catalysent de nombreuses réactions importantes, il est essentiel d'obtenir suffisamment de vitamines et de minéraux à partir de l'alimentation et des suppléments. La vitamine C (acide ascorbique) est une coenzyme nécessaire à l'action des enzymes qui construisent le collagène, un composant protéique important du tissu conjonctif dans tout le corps. L'ion magnésium (Mg++) est un cofacteur important qui est nécessaire à l'enzyme pyruvate déshydrogénase pour catalyser une partie de la voie qui décompose le sucre pour produire de l'énergie. Les vitamines ne peuvent pas être produites dans le corps humain et doivent donc être obtenues dans l'alimentation.

Expliquez dans vos propres mots comment la rétro-inhibition enzymatique profite à une cellule.

L'inhibition de la rétroaction permet aux cellules de contrôler les quantités de produits métaboliques produites. S'il y a trop d'un produit particulier par rapport aux besoins de la cellule, la rétro-inhibition amène effectivement la cellule à diminuer la production de ce produit particulier. En général, cela réduit la production de produits superflus et économise l'énergie, maximisant ainsi l'efficacité énergétique.

Glossaire


Discussion

À notre connaissance, nous présentons la première preuve directe de la collaboration de Cdc48 et du protéasome 26S dans la dégradation de protéines compactes et bien repliées, où le démêlage par Cdc48 génère des régions d'initiation flexibles qui permettent le traitement ultérieur du protéasome. Notre reconstitution identifie Cdc48•UN et l'holoenzyme du protéasome comme les composants minimalement requis pour cette dégradation couplée, indépendamment des récepteurs navettes comme Rad23 ou la deubiquitinase Otu1. Les chaînes d'ubiquitine relativement courtes et ramifiées sur nos substrats modèles semblent se déplier et co-transloquées par Cdc48, et peuvent ensuite se replier plus rapidement que le substrat lui-même, permettant la liaison ubiquitine-récepteur tandis qu'une région non structurée du substrat polypeptide peut s'engager avec le Moteur ATPase du protéasome. Il est intéressant de noter que la plupart des modifications de la poly-ubiquitine sur les protéines dans le lysat soluble de levure incluent jusqu'à sept fragments d'ubiquitine 32 , qui, selon nos résultats et les précédents 19, devraient permettre une translocation complète par Cdc48 sans avoir besoin de désubiquitination par Otu1.

Nous avons conçu le substrat ubiquitiné pour qu'il manque de lieurs ou de terminaisons flexibles, et on ne sait toujours pas où Cdc48 initie le dépliage. Des études structurelles récentes ont suggéré que l'adaptateur UN positionne l'ubiquitine près du pore central de Cdc48, de sorte que le dépliement peut commencer sur un segment de la partie proximale de l'ubiquitine, ce qui constituerait un site d'initiation universel pour la translocation quel que soit le polypeptide substrat attaché 19 . Nous concluons sur la base de nos résultats que l'effilochage initial doit être facilité par les domaines D1 et/ou les domaines N-terminaux de Cdc48. Le dépliage et l'enfilage uniquement par les domaines D2, comme proposé précédemment, nécessiteraient que le substrat contienne une région d'initiation flexible de longueur similaire à celle de l'engagement protéasomal, ce qui n'est clairement pas le cas.

Après le dépliement complet, le substrat est probablement libéré par Cdc48 et diffuse vers le protéasome 26S, mais des études futures pourront déterminer si une interaction directe entre ces machines moléculaires se produit pour le transfert du substrat. Alors que les réactions concurrentes dans nos conditions expérimentales ont empêché de mesurer la vitesse maximale de la dégradation du protéasome couplée à Cdc48, le transfert de substrat in vivo devrait être facilité par des interactions avec les récepteurs navette Rad23 et Dsk2, qui peuvent stabiliser l'état déplié des substrats et augmenter leur affinité. pour le protéasome 33,34,35 . De plus, la deubiquitinase Otu1 liée à Cdc48 et la ligase E4 Ufd2 peuvent modifier et étendre les modifications de l'ubiquitine attachée au substrat à Cdc48 pour favoriser la liaison au protéasome et restreindre la reliaison concurrente aux adaptateurs pour Cdc48.

Cdc48 est impliqué dans une myriade de processus, et toute son activité de déploiement ne conduit pas à la dégradation. Notre système reconstitué permet d'importantes recherches futures sur la façon dont Cdc48 et le protéasome décident du sort d'une protéine, comment différentes modifications de l'ubiquitine sont reconnues par les adaptateurs Cdc48 et le protéasome, et comment ces modifications peuvent être modifiées par Otu1 et Ufd2 pour moduler le traitement du substrat et déterminer l'ordre des interactions avec ces machines moléculaires.


Discussion

Dans la présente étude, nous avons constaté que la deuxième division méiotique des œufs de souris était associée à une période de destruction des protéines contenant un motif D- ou KEN-box, compatible avec l'activité d'APC cdc20 et d'APC cdh1 lors de la fécondation. Après l'insémination, une série de pointes de Ca 2+ déclenchées par le sperme a rapidement induit la destruction de la sécurine et de la cycline B1 dans les ovules. Leur destruction était complète au moment où l'activité de CDK1 avait diminué et le deuxième corps polaire avait été extrudé. Étant donné que la cycline B1 et la sécurine contiennent toutes deux une boîte D, cette dégradation pourrait potentiellement être due à APC cdc20 et/ou APC cdh1 . Cependant, dans les œufs MII, nous avons observé que la protéine cdh1 était phosphorylée, ce qui dans les cellules mitotiques l'empêche de se lier à l'APC/C. L'incapacité de cdh1 à activer l'APC/C au MII a été confirmée directement en utilisant des substrats d'APC cdh1 qui n'étaient pas reconnus par APC cdc20. Ainsi, nous avons utilisé cdc20 lui-même et une forme mutée de D-box de sécurine qui contiennent toutes deux une boîte KEN, pour générer des protéines de fusion GFP qui étaient des substrats d'APC cdh1 . Ces deux constructions étaient initialement stables dans les œufs fécondés, mais leur dégradation a commencé brusquement 1 à 2 heures après le pic de Ca 2+ déclenché par le sperme, au moment de l'extrusion du corps polaire. Leur dégradation s'est poursuivie jusqu'à ce que la méiose II soit terminée et que des pronoyaux se soient formés dans l'embryon à 1 cellule. Par conséquent, il n'y a pas eu d'activation immédiate d'APC cdh1 lors de la fécondation, mais il semble qu'il y ait eu un passage de l'activité d'APC cdc20 à l'activité d'APC cdh1 au moment de la deuxième extrusion du corps polaire (ceci est illustré sur la figure 8). Tous les substrats de l'APC/C semblaient stables après la formation du pronucleus.

Modèle d'activation d'APC cdc20 et d'APC cdh1 pendant la méiose II. Les œufs MII non fécondés, qui ont des niveaux élevés de CDK1, ont une faible activité APC cdc20 et APC cdh1. Un signal Ca 2+ dérivé du sperme initie l'activation de l'APC cdc20 lors de la fusion des gamètes, qui est responsable de la dégradation de la cycline B1/sécurine et d'une perte associée de l'activité CDK1. La dégradation de ces substrats d'APC cdc20 permet la formation d'un second corps polaire et à ce moment l'activité d'APC cdh1 apparaît. APC cdh1 est responsable de la dégradation des substrats KEN-box tels que cdc20. L'activité d'APC cdh1 chute lorsque des pronoyaux se forment et que le zygote entre en phase S du premier cycle cellulaire embryonnaire.

Modèle d'activation d'APC cdc20 et d'APC cdh1 pendant la méiose II. Les œufs MII non fécondés, qui ont des niveaux élevés de CDK1, ont une faible activité APC cdc20 et APC cdh1. Un signal Ca 2+ dérivé du sperme initie l'activation de l'APC cdc20 lors de la fusion des gamètes, qui est responsable de la dégradation de la cycline B1/sécurine et d'une perte associée de l'activité CDK1. La dégradation de ces substrats d'APC cdc20 permet la formation d'un second corps polaire et à ce moment l'activité d'APC cdh1 apparaît. APC cdh1 est responsable de la dégradation des substrats KEN-box tels que cdc20. L'activité d'APC cdh1 chute lorsque des pronoyaux se forment et que le zygote entre en phase S du premier cycle cellulaire embryonnaire.

Activation d'APC cdc20 par Ca 2+

Les spermatozoïdes déclenchent une série de pointes de Ca 2+ de longue durée en libérant dans l'ovule un membre spécifique du sperme de la famille des phospholipases C (PLC), PLCζ (Saunders et al., 2002). Ce PLC soulève des oeufs InsP3 niveaux, résultant ainsi en un train de pointes de Ca 2+ (Jones et Nixon, 2000). Le dopage de Ca 2+, dans un processus médié par une protéine kinase II dépendante de la calmoduline (Markoulaki et al., 2003 Markoulaki et al., 2004), est le déclencheur nécessaire et suffisant pour la reprise de la méiose après un arrêt MII (Hyslop et al. ., 2004). La protéolyse dépendante de la boîte D de la cycline B1 (Nixon et al., 2002) et de la sécurine (données actuelles) commence en même temps quelques minutes seulement après le premier pic de Ca 2+. Nous interprétons cela comme signifiant que l'activation de la ligase E3 APC cdc20 se produit peu de temps après le début du dopage de la même manière que l'APC cdc20 s'est avérée être activée, et essentielle, lors de l'activation des œufs de grenouille (Lorca et al., 1998). Cependant, les œufs de souris expriment également RFLP4, une ligase E3 dont les substrats incluent la cycline B1 (Suzumori et al., 2003) qui peut remplir la même fonction que l'APC cdc20 en effet de nouvelles variantes de méiose de cdc20 ont été décrites chez la levure (Cooper et al., 2000) et Drosophile (Chu et al., 2001). Les données actuelles n'excluent pas une fonction de RFLP4 dans la méiose de la souris.Cependant, nous montrons ici que les œufs de souris contiennent du cdc20, et nous avons précédemment démontré que la reprise du cycle cellulaire médiée par le Ca 2+ et la dégradation de la cycline B1 peuvent être bloquées par l'induction d'un point de contrôle de fuseau (Jones et al., 1995 Nixon et al. , 2002). Cela soutiendrait un rôle pour APC cdc20 puisque l'activation du point de contrôle du fuseau est un puissant répresseur de l'activité d'APC cdc20 (Yu, 2002). Cet effet est médié par mad2, l'une des protéines du point de contrôle du fuseau, qui se lie spécifiquement et directement à cdc20 (Luo et al., 2000). Par conséquent, il est probable que RFLP4 puisse avoir un rôle spécifique au cours de la méiose I, ou bien contribue à la dégradation de la sécurine/cycline B1 au cours de la méiose II, une fois que l'APC/C a été activé.

À l'appui de l'APC cdc20 ayant un rôle au cours de la méiose II est l'observation que les substrats contenant à la fois D-box et KEN-box sont ciblés pour la protéolyse lorsque l'activité CDK1 chute à la deuxième extrusion du corps polaire. Cela implique un passage de l'activité d'APC cdc20 à l'activité d'APC cdh1 à ce moment-là. Ce changement ne se produit pas dans les œufs de grenouille qui manquent de protéine cdh1, mais le moment de ce changement serait cohérent avec celui rapporté par les études mitotiques dans les cellules de mammifères (Hagting et al., 2002 Zur et Brandeis, 2002) et la régulation négative de cdh1 par MPF.

A l'heure actuelle, on ne sait pas comment l'activation par le Ca 2+ de la protéine kinase II dépendante de la calmoduline conduit à l'activation de l'APC cdc20 . Historiquement, le terme "facteur cytostatique" a été utilisé pour décrire l'activité dans les œufs qui est responsable de l'arrêt du MII. L'activité du facteur cytostatique est susceptible de constituer une répression de l'activité de l'APC cdc20. En effet, certains candidats ayant une activité de facteur cytostatique sont des inhibiteurs de l'APC cdc20. Ceux-ci incluent Emi1, qui se lie au cdc20 et, ce faisant, empêche le cdc20 de se lier à l'APC/C (Reimann et Jackson, 2002), et divers composants du point de contrôle du fuseau (Schwab et al., 2001 Tunquist et al., 2003).

Pourquoi certains œufs ont cdh1 et d'autres pas

D'autres études sont nécessaires pour déterminer à la fois la fonction et la régulation de l'APC cdh1 pendant la méiose II de la souris, et en plus, puisque nous avons observé sa présence à tous les stades de la maturation ovocytaire, son rôle dans la première division méiotique. Il est possible que l'APC cdh1 de la souris soit éteinte pendant la méiose I, car par analogie chez la levure bourgeonnante, un inhibiteur spécifique de la méiose de cdh1 empêche l'activité de l'APC cdh1 pendant la première division méiotique (Bolte et al., 2002). Le présent travail pointe vers un rôle de l'activité CDK1 dans la régulation de l'APC cdh1 au cours de la méiose II, mais rien n'est connu sur le rôle de la phosphatase cdc14, qui est nécessaire pour activer cdh1, dans les œufs de souris. Ainsi, de futures études devraient examiner comment cdh1 est régulé par CDK1/cdc14 au cours des deux divisions méiotiques, qui ne sont temporellement séparées que de quelques heures. Dans la division mitotique, l'activité cdh1 semble facilement dispensable, de sorte que les cellules peuvent toujours sortir de la mitose en l'absence de cdh1. Par conséquent, il est possible que cdh1 puisse être supprimé pour le processus d'achèvement de la méiose II. Cependant, APC cdh1 s'est avéré avoir des fonctions spécifiques plus tard dans le cycle cellulaire à G1, il est responsable de rendre un point de contrôle G1-S admissible (Sudo et al., 2001) et d'empêcher l'entrée prématurée dans la phase S (Bashir et al. , 2004 Wei et al., 2004). L'APC cdh1 semble également avoir des fonctions en dehors du cycle cellulaire, comme dans les neurones post-mitotiques où elle régule la croissance des axones (Konishi et al., 2004) et dans certaines études, sa présence s'est avérée associée à l'apparition de différenciation cellulaire (Blanco et al., 2000). Il sera donc intéressant de déterminer quel rôle joue la cdh1 maternelle dans les embryons jusqu'à l'activation du génome zygotique.

La plupart des divisions cellulaires, y compris celles qui se produisent dans les premiers embryons de souris et les divisions mitotiques de mammifères, ont des phases de brèche associées à leur cycle cellulaire et il y aurait donc un besoin de cdh1 dans G1 pour réguler l'entrée en phase S. Cependant, les œufs de certaines espèces, illustrés par Xénope, C. elegans et Drosophile, semblent avoir supprimé les phases de brèche. Sur la base de la découverte actuelle de l'activité d'APC cdc20 et d'APC cdh1 pendant la méiose II dans les œufs de souris, il n'est probablement pas vrai que le cycle cellulaire embryonnaire est fondamentalement différent du cycle cellulaire dans les cellules adultes. Au contraire, le manque d'activité cdh1 dans les œufs et les embryons de certaines espèces reflète probablement la nécessité d'accélérer le cycle cellulaire afin d'atteindre un stade mobile et d'éviter la prédation.


La dynamique de la -sécrétase et de ses substrats

La γ-secretase est une aspartyl-protéase intramembranaire catalysant l'étape finale de la protéolyse intramembranaire régulée d'un grand nombre de protéines transmembranaires de type 1 à travée unique. Les substrats les plus étudiés sont la protéine précurseur amyloïde-β (APP) et les récepteurs NOTCH. Une technique importante pour la caractérisation des interactions et des changements de conformation permettant à la -sécrétase d'effectuer une hydrolyse dans les limites de la membrane sont les simulations de dynamique moléculaire à différentes échelles de temps et de longueur. Ici, nous passons en revue les caractéristiques structurelles et dynamiques de la −secretase et de ses substrats, y compris des descriptions de flexibilité à partir de simulations et d'expériences. Nous abordons (1) l'échantillonnage conformationnel des apo-enzymes et des substrats non liés (exemplifiés pour APP, NOTCH1 et l'intégrine apparente sans substrat 1), (2) les voies de recrutement du substrat, (3) les changements conformationnels associés à la formation du complexe de reconnaissance , (4) le dépliement du site de clivage lors de l'interaction avec le site actif de l'enzyme, (5) le traitement du substrat après endoprotéolyse et (6) l'inhibition et la modulation de la -sécrétase. Nous concluons avec des questions encore ouvertes et suggérons d'autres investigations afin de faire progresser notre compréhension de la façon dont la γ-sécrétase sélectionne et traite les substrats. Cette connaissance améliorera la capacité de mieux cibler les substrats de manière sélective pour des applications thérapeutiques.


Contenu

UNE transporteur n'est pas ouvert simultanément aux environnements extracellulaire et intracellulaire. Soit sa porte intérieure est ouverte, soit sa porte extérieure est ouverte. En revanche, un canaliser peut être ouvert aux deux environnements en même temps, permettant aux molécules de se diffuser sans interruption. Les porteurs ont des sites de liaison, mais pas les pores et les canaux. [5] [6] [7] Lorsqu'un canal est ouvert, des millions d'ions peuvent traverser la membrane par seconde, mais seulement 100 à 1000 molécules traversent généralement une molécule porteuse en même temps. [8] Chaque protéine porteuse est conçue pour reconnaître une seule substance ou un groupe de substances très similaires. La recherche a corrélé des défauts dans des protéines porteuses spécifiques avec des maladies spécifiques. [9]

Le transport actif est le mouvement d'une substance à travers une membrane contre son gradient de concentration. Il s'agit généralement d'accumuler de fortes concentrations de molécules dont une cellule a besoin, comme le glucose ou les acides aminés. Si le processus utilise de l'énergie chimique, telle que l'adénosine triphosphate (ATP), on parle de transport actif primaire. Le transport actif secondaire implique l'utilisation d'un gradient électrochimique et n'utilise pas l'énergie produite dans la cellule. [10] Contrairement aux protéines de canal qui ne transportent que passivement des substances à travers les membranes, les protéines porteuses peuvent transporter des ions et des molécules soit passivement par diffusion facilitée, soit via un transport actif secondaire. [11] Une protéine porteuse est nécessaire pour déplacer les particules des zones de faible concentration vers les zones de forte concentration. Ces protéines porteuses ont des récepteurs qui se lient à une molécule spécifique (substrat) nécessitant un transport. La molécule ou l'ion à transporter (le substrat) doit d'abord se lier à un site de liaison de la molécule porteuse, avec une certaine affinité de liaison. Après la liaison, et tandis que le site de liaison fait face dans le même sens, le support va capturer ou occlure (prendre et retenir) le substrat dans sa structure moléculaire et provoquer une translocation interne de sorte que l'ouverture dans la protéine fait maintenant face à l'autre côté de la membrane plasmique. [12] Le substrat de la protéine porteuse est libéré sur ce site, en fonction de son affinité de liaison.

La diffusion facilitée est le passage de molécules ou d'ions à travers une membrane biologique à travers des protéines de transport spécifiques et ne nécessite aucun apport d'énergie. La diffusion facilitée est utilisée en particulier dans le cas de grosses molécules polaires et d'ions chargés une fois que ces ions sont dissous dans l'eau, ils ne peuvent pas diffuser librement à travers les membranes cellulaires en raison de la nature hydrophobe des queues d'acides gras des phospholipides qui composent les bicouches. Le type de protéines porteuses utilisées dans la diffusion facilitée est légèrement différent de ceux utilisés dans le transport actif. Ce sont toujours des protéines porteuses transmembranaires, mais ce sont des canaux transmembranaires fermés, ce qui signifie qu'ils ne subissent pas de translocation interne et ne nécessitent pas d'ATP pour fonctionner. Le substrat est pris dans un côté du support fermé, et sans utiliser d'ATP, le substrat est libéré dans la cellule. Ils peuvent être utilisés comme biomarqueurs potentiels.

Le transport inverse, ou renversement de transporteur, est un phénomène dans lequel les substrats d'une protéine de transport membranaire sont déplacés dans la direction opposée à celle de leur mouvement typique par le transporteur. [13] [14] [15] [16] [17] L'inversion du transporteur se produit généralement lorsqu'une protéine de transport membranaire est phosphorylée par une protéine kinase particulière, qui est une enzyme qui ajoute un groupe phosphate aux protéines. [13] [14]

1: Canaux/pores Modifier

  • Canaux protéiques -hélicoïdaux tels que le canal ionique voltage-dépendant (VIC), les canaux ioniques ligand-dépendants (LGIC)
  • Porines -baril telles que l'aquaporine
  • toxines formant des canaux, y compris les colicines, la toxine diphtérique et autres
  • Canaux synthétisés non ribosomiques tels que la gramicidine qui fonctionnent dans l'exportation d'enzymes qui digèrent les parois cellulaires bactériennes dans une étape précoce de la lyse cellulaire.

La diffusion facilitée se produit à l'intérieur et à l'extérieur de la membrane cellulaire via des canaux/pores et des porteurs/porteurs.

Les canaux sont soit à l'état ouvert, soit à l'état fermé. Lorsqu'un canal est ouvert avec un léger changement de conformation, il est ouvert aux deux environnements simultanément (extracellulaire et intracellulaire)

Les pores sont continuellement ouverts à ces deux environnements, car ils ne subissent pas de changements de conformation. Ils sont toujours ouverts et actifs.

2: Transporteurs électrochimiques commandés par le potentiel Modifier

Également appelées protéines porteuses ou transporteurs secondaires.

3: principaux transporteurs actifs Modifier

    3.A : transporteurs entraînés par l'hydrolyse de la liaison P-P :
      (transporteur ABC), tels que MDR, CFTR ("V" lié à vacuolaire). ("P" lié à la phosphorylation), tels que :

    4: Translocateurs de groupe Modifier

    Les translocateurs de groupe fournissent un mécanisme spécial pour la phosphorylation des sucres lors de leur transport dans les bactéries (translocation de groupe PEP)

    5: porteurs d'électrons Modifier

    Les porteurs de transfert d'électrons transmembranaires dans la membrane comprennent des porteurs à deux électrons, tels que les oxydoréductases à liaison disulfure (DsbB et DsbD dans E. coli) ainsi que des porteurs à un électron tels que la NADPH oxydase. Souvent, ces protéines redox ne sont pas considérées comme des protéines de transport.

    Chaque protéine porteuse, en particulier au sein de la même membrane cellulaire, est spécifique à un type ou à une famille de molécules. Par exemple, GLUT1 est une protéine porteuse nommée présente dans presque toutes les membranes cellulaires animales qui transporte le glucose à travers la bicouche. D'autres protéines porteuses spécifiques aident également le corps à fonctionner de manière importante. Les cytochromes fonctionnent dans la chaîne de transport d'électrons en tant que protéines porteuses d'électrons. [dix]

    Un certain nombre de maladies héréditaires impliquent des défauts dans les protéines porteuses dans une substance ou un groupe de cellules particulier. La cystéinurie (cystéine dans l'urine et la vessie) est une telle maladie impliquant des protéines porteuses de cystéine défectueuses dans les membranes des cellules rénales. Ce système de transport élimine normalement la cystéine du liquide destiné à devenir l'urine et renvoie cet acide aminé essentiel au sang. Lorsque ce transporteur fonctionne mal, de grandes quantités de cystéine restent dans l'urine, où elle est relativement insoluble et a tendance à précipiter. C'est l'une des causes des calculs urinaires. [18] Certaines protéines porteuses de vitamines se sont révélées surexprimées chez les patients atteints d'une maladie maligne. Par exemple, il a été démontré que les niveaux de protéine porteuse de la riboflavine (RCP) sont significativement élevés chez les personnes atteintes d'un cancer du sein. [19]

    1. ^Membrane+transport+protéines à la National Library of Medicine Medical Subject Headings (MeSH) des États-Unis
    2. ^ Perland, Emelie Bagchi, Sonchita Klaesson, Axel Fredriksson, Robert (2017-09-01). « Caractéristiques de 29 nouveaux porteurs de solutés atypiques de type de superfamille de facilitateur majeur : conservation évolutive, structure prédite et co-expression neuronale ». Biologie ouverte. 7 (9) : 170142. doi : 10.1098/rsob.170142. ISSN2046-2441. PMC5627054. PMID28878041.
    3. ^
    4. Hediger, Matthias A. Romero, Michael F. Peng, Ji-Bin Rolfs, Andreas Takanaga, Hitomi Bruford, Elspeth A. (février 2004). « L'ABC des porteurs de soluté : implications physiologiques, pathologiques et thérapeutiques des protéines de transport membranaire humaines Introduction ». Archiv de Pflügers : Journal européen de physiologie. 447 (5) : 465-468. doi:10.1007/s00424-003-1192-y. ISSN0031-6768. PMID14624363. S2CID1866661.
    5. ^ uneb
    6. Perland, Emelie Fredriksson, Robert (mars 2017). « Systèmes de classification des transporteurs actifs secondaires ». Tendances en sciences pharmacologiques. 38 (3) : 305-315. doi:10.1016/j.tips.2016.11.008. ISSN1873-3735. PMID27939446.
    7. ^ Sadava, David et al. La vie, la science de la biologie, 9e édition. Éditions Macmillan, 2009. 1-4292-1962-9. p. 119.
    8. ^
    9. Cooper, Geoffrey (2009). La cellule : une approche moléculaire. Washington, DC : Presse ASM. p. 62. ISBN9780878933006.
    10. ^ Thompson, Liz A. Passage du test de fin de cours de biologie en Caroline du Nord. American Book Company, Inc. 2007. 1-59807-139-4. p. 97.
    11. ^
    12. Assmann, Sarah (2015). "Transport Soluté". À Ta’izz, Lincoln Zeiger, Edward (éd.). Physiologie et développement des plantes. Sinauer. p. 151.
    13. ^ Sadava, David, et al. La vie, la science de la biologie, 9e édition. Éditions Macmillan, 2009. 1-4292-1962-9. p. 119.
    14. ^ uneb Ashley, Ruth. Hann, Gary. Han, Seong S. Biologie cellulaire. Éditeurs internationaux New Age. 8122413978. p. 113.
    15. ^ Ta’izz, Lincoln. Zeigler, Eduardo. Physiologie et développement des plantes. Sinauer Associates, 2015. 978-1-60535-255-8. p. 151.
    16. ^ Kent, Michel. Biologie avancée. Oxford University Press US, 2000. 0-19-914195-9. p. 157-158.
    17. ^ uneb
    18. Bermingham DP, Blakely RD (octobre 2016). « Régulation dépendante de la kinase des transporteurs de neurotransmetteurs monoamines ». Pharmacol. Tour. 68 (4) : 888-953. doi:10.1124/pr.115.012260. PMC5050440 . PMID27591044.
    19. ^ uneb
    20. Miller GM (janvier 2011). « Le rôle émergent du récepteur 1 associé aux traces d'amines dans la régulation fonctionnelle des transporteurs de monoamines et de l'activité dopaminergique ». Journal de neurochimie. 116 (2) : 164-176. doi: 10.1111/j.1471-4159.2010.07109.x. PMC3005101 . PMID21073468.
    21. ^
    22. Scholze P, Nørregaard L, Singer EA, Freissmuth M, Gether U, Sitte HH (2002). « Le rôle des ions zinc dans le transport inverse médié par les transporteurs de monoamine ». Le Journal de Chimie Biologique. 277 (24) : 21505-13. doi: 10.1074/jbc.M112265200 . PMID11940571.
    23. ^
    24. Robertson SD, Matthies HJ, Galli A (2009). « Un examen plus approfondi du transport inverse induit par les amphétamines et du trafic des transporteurs de dopamine et de noradrénaline ». Neurobiologie moléculaire. 39 (2) : 73-80. doi:10.1007/s12035-009-8053-4. PMC2729543 . PMID19199083.
    25. ^
    26. Kasatkina LA, Borisova TA (novembre 2013). « Libération de glutamate par les plaquettes : exocytose par rapport à l'inversion du transporteur de glutamate ». The International Journal of Biochemistry & Cell Biology. 45 (11) : 2585-2595. doi:10.1016/j.biocel.2013.08.004. PMID23994539.
    27. ^ Sherwood, Lauralee. 7e édition. Physiologie humaine. Des cellules aux systèmes. Cengage Learning, 2008. p. 67
    28. ^ Rao, PN, Levine, E et al. Élévation de la protéine porteuse sérique de la riboflavine dans le cancer du sein. Biomarqueurs de l'épidémiol du cancer Préc. Volume 8 n° 11. p. 985-990

    Anderle, P., Barbacioru, C., Bussey, K., Dai, Z., Huang, Y., Papp, A., Reinhold, W., Sadee, W., Shankavaram, U., & Weinstein, J. (2004). Transporteurs et canaux membranaires: Rôle du transportome dans la chimiosensibilité et la chimiorésistance du cancer. Recherche sur le cancer, 54, 4294-4301.


    MATÉRIAUX ET MÉTHODES

    Culture de cellules

    Les cellules COS-1, HeLa et Vero ont été maintenues dans du DMEM (Invitrogen, Carlsbad, CA) dans des conditions standard. Les transfections ont été réalisées avec 1-2 g des vecteurs appropriés comme décrit précédemment (Chen et Okayama, 1987 Raggo et al., 2002). Lorsque cela était indiqué, de la brefeldine A (concentration finale de 1 g/ml) a été ajoutée aux cellules ∼ 24 h après la transfection, et les cultures ont été encore incubées pendant 4 à 8 h. Pour les études examinant l'effet de l'induction de la réponse protéique non repliée, du DTT a été ajouté dans un milieu normal avec les temps et les concentrations indiqués dans les légendes des figures.

    Plasmides

    La construction d'un vecteur (pJS6), contenant la séquence codante de Luman (CREB3), flanqué d'une étiquette d'épitope SV5 à son extrémité N et d'une étiquette d'hémagglutinine (HA) à son extrémité C, a été décrite précédemment (Raggo et al., 2002). La séquence codante de CREB4 a été amplifiée à partir d'une banque d'ADNc HeLa (Marathon Ready cDNA BD Biosciences Clontech, Palo Alto, CA), en utilisant les amorces AGATCTATGGATCTCGGAATCCCTGACCC et CTCGAGCATCTCATCTG CATGCAGCACGG, dans lequel un BglII et XhoI site ont été incorporés sur les amorces 5' et 3', respectivement, pour faciliter les étapes de clonage ultérieures. L'ATG souligné représente l'initiateur méthionine, et l'amorce 3' est conçue de sorte que le dernier triplet codant soit lu dans le cadre d'une étiquette C-terminale après les étapes de clonage suivantes. Le fragment amplifié a ensuite été digéré avec BglII et XhoI, et inséré dans le BamBonjour et XhoI sites de pJS6, créant une construction qui exprimait CREB4 intact (pJS23), marqué aux extrémités N et C. Utiliser un natif Bamsite HI juste en aval du site de départ CREB4, un BamSALUT-XhoI fragment a également été cloné entre le BamBonjour et XhoI sites de pJS6 créant un vecteur qui exprimait une version de CREB4 dépourvue des 22 premiers résidus (pJS24 CREB.ΔN1).

    Une chimère constituée du domaine N-terminal de CREB4 (1-275) fusionné aux domaines transmembranaire et C-terminal de Luman a été construite par digestion de pJS23 avec BlpI, un site naturel unique juste avant le traitement du domaine transmembranaire putatif avec la polymérase T4 pour éliminer les extensions 3' et la digestion avec XhoI. Cela a éliminé le domaine transmembranaire et C-terminal de CREB4 (résidus 276-395). Un fragment (ÉcoVR-XhoI) de pJS6 contenant la queue transmembranaire et C-terminale de Luman (résidus 220-371) a ensuite été inséré pour créer pJS42 (CH2). Une chimère constituée du domaine N-terminal et de la région transmembranaire de CREB4 (1-324) fusionnés au domaine luminal C-terminal de CREB3 (258-371) a été créée en amplifiant le domaine N-terminal et transmembranaire de CREB4 en utilisant les amorces AGATCTATGGATCTCGGAATCCCTGACCC et AGATCTAGACCCAGCTTCTGGTCGAC. Celui-ci a été cloné entre le BamHI au terminus N et à l'intérieur BlpI site de pJS6 pour créer un vecteur pJS43 (CH3). Une chimère supplémentaire a été construite (pJS66, CH6) qui contenait l'extrémité N de CREB4, y compris les sites transmembranaires et S1P, liés au domaine luminal de Luman. Pour cela, un fragment Luman C-terminal a été amplifié à l'aide des amorces CTCGAGGCCCTCCCCAGTGAGGACCCTTAC et GATCCTCGAG GCCTGAGTATC TGTCCAG et cloné dans le XhoI de pJS60 pour créer une chimère composée des 344 résidus N-terminaux de CREB4 suivis des résidus 269-371 de Luman. Enfin, une chimère réciproque contenant l'extrémité N de CREB3 avec le domaine transmembranaire et l'extrémité C de CREB4 (pJS58, CH4) a été construite en remplaçant un ÉcoVR-XhoJe fragmente pJS6 avec un BlpJE-XhoJe fragmente à partir de pJS23.

    Pour les mutants par délétion, CREB4.ΔTM (pJS32) était par ailleurs de pleine longueur mais contenait une délétion interne pour éliminer le domaine transmembranaire putatif (résidus 281-313). D'autres constructions de délétion contenaient la partie N-terminale de la protéine, CREB.ΔTMC1, tronquée au résidu 276 et dépourvue de la région transmembranaire et C-terminale CREB4.ΔC1, tronquée au résidu 319, et comprenant la région transmembranaire mais dépourvue du site S1P putatif en position 335-338 CREB4.ΔC2, tronqué au résidu 344 et contenant l'extrémité N plus le domaine transmembranaire et le site S1P putatif. Les résidus 1-344 ont été amplifiés à l'aide des amorces AGATCTATGGATCTCGGAATCCCTGACCC et CTCGAGTGTTACGTCCTTGTGGGTCAGG, et l'ADNc résultant a été cloné entre le BamBonjour et XhoI sites de pJS23. CREB4.ΔC1 a été fabriqué en digérant pJS23 avec Salmoi et XhoMoi, traitant avec Klenow et religuant. Celui-ci contient les résidus 1 à 319 de CREB4 et comprend sept résidus (HKGEPAS) avant le nouveau codon d'arrêt. Toutes les constructions ont été confirmées par séquençage et leurs structures sont résumées dans les figures appropriées.

    Les fusions du domaine de liaison à l'ADN CREB 4 à GAL4 ont été construites en utilisant le domaine de liaison à l'ADN GAL4 pM1 (Sadowski et al., 1992). CREB4 a été amplifié à partir de pJS23 en utilisant les amorces GAATTCATGGATCTCGGAATCCCTGAC et CTCGAGTTACAGGCTGGCATAGTCAGGC. Ce produit, contenant CREB4 pleine longueur avec l'ajout d'une étiquette HA à l'extrémité C suivie d'un codon de terminaison a été digéré avec ÉcoIR et XhoI et inséré entre le ÉcoIR et SalI sites de pM1 pour produire pJS55, exprimant le domaine de liaison à l'ADN GAL4 fusionné à CREB4 pleine longueur. Pour produire une fusion GAL4 à la région N-terminale uniquement de CREB4, pJS44 (CREB.ΔTMC1) a été digéré avec De derrièreIII et XbaI pour isoler les résidus N-terminaux 1-276, qui ont été clonés entre le De derrièreIII et XbaI sites de pJS55 pour produire pJS62.

    Un vecteur exprimant une protéine de fusion verte fluorescente (GFP)-CREB4 a été construit. En insérant un fragment (NdeJE-BamHI) contenant la séquence codante pour la GFP de pEGFP-C1 (BD Biosciences Clontech) dans pJS23 pour créer un vecteur qui exprime une protéine de fusion de CREB4.ΔN1 avec la GFP à l'extrémité N (pJS51). Les BglII-BlpI fragment de CREB4 intact a ensuite été transféré dans le BamBonjour et BlpSites I de pJS51 exprimant la protéine de fusion GFP-CREB4 intacte avec la GFP à l'extrémité N (pJS52).

    Pour construire un vecteur d'expression pour OASIS, l'ADNc (ID IMAGE 4856946) a été digéré avec BamSALUT. Le clone d'ADNc contient un natif Bamsite HI au résidu 17 d'OASIS et un BamHI dans le vecteur plasmidique. Le 1,5 ko BamLe fragment HI englobant les résidus 17 jusqu'au résidu C-terminal (519) a ensuite été transféré à pJS6 pour créer le vecteur intermédiaire pJS6OAS1. Pour construire le vecteur d'expression de telle sorte qu'OASIS contienne le même marqueur HA C-terminal que les autres constructions, les amorces GGTCACCAACAAGATCTCCAGACC contenant un Bstsite EII et CTCGAGGGAGAGTTTGATGGTGG contenant un XhoI ont été utilisés pour amplifier l'extrémité 3' de la région codante (résidus 354-519), de sorte que la région se lise dans le cadre lorsqu'elle est insérée dans pJS6OAS1. Le fragment d'ADNc digéré par BstEII et XhoJ'ai ensuite été inséré entre le BstSites EII (dans Oasis) et XhoI (Vector) de pJS6OAS1 pour créer un deuxième vecteur intermédiaire, pJS6OAS2. Pour compléter le clonage, l'extrémité 5' de la région codante OASIS a ensuite été amplifiée à partir du clone Image cDNA en utilisant les amorces (AGATCTATGGACGCCGTCTTGG) et (TCCGGACTCTCTTCAAGGCCTTC). Ce fragment de 874 pb a été digéré avec BglII et BspEI et cloné entre le BamSalut et le natif Bspsites EI de pJS6OAS2 pour produire une construction qui exprime une OASIS intacte avec l'épitope SV5 à l'extrémité N et l'épitope HA à l'extrémité C (pJS22).

    La stratégie pour construire un vecteur d'expression pour CREB-H était la même que celle décrite ci-dessus pour CREB4 à partir d'une banque d'ADNc HeLa en utilisant les amorces CGCGGATCCATGAATACGGATTTAGCTGC et ACGCGTCGACCAGCTCGTCTCCCGCCGCCT. Le fragment BamSALUT-SalJ'ai été cloné dans le BamSALUT-XhoI sites de pJS6 (pSM20). La construction exprimant ATF6 (p3XFLAG-CMV-ATF6) et le variant N-terminal 1-373 ont été aimablement fournis par le Dr Ron Prywes (Department of Biological Sciences, Columbia University, New York, NY). Les vecteurs d'expression pour S1P ont été aimablement fournis par le Dr Joseph Goldstein (Department of Molecular Genetics, University of Texas, Southwestern Medical Center, Dallas, TX).

    Mutagenèse

    La mutation du site de clivage S1P au sein de CREB4 a été réalisée en utilisant le kit QuikChange (Stratagene, La Jolla, CA). Au sein de CREB4, la séquence 335-RNIL-338 est située à environ 20 résidus en aval de la région transmembranaire. Une version mutante de CREB4 (pJS50) ou du CREB4.ΔC2 tronqué (pJS67) qui contenait une seule substitution d'acide aminé (R335G) dans ce motif a été créée à l'aide des amorces GGAGTGACTTCCGGAAATATCCTGACCCACAAGG et CCTTGTGGGTCAGGATATTTCCGGAAGTCACTCC. Les plasmides parentaux pJS24 ou pJS60 ont été dénaturés et incubés avec les amorces selon les instructions du fabricant. Une fois la réaction terminée, l'échantillon a été digéré avec DpnI pour supprimer le modèle de plasmide parental, puis transformé. L'insertion de la mutation dans cette construction comme pour toutes les constructions a été confirmée par séquençage plasmidique.

    Immunofluorescence

    Les cellules cultivées sur des lamelles ont été transfectées avec 2 ug du vecteur d'expression approprié. Environ 30 h après la transfection, les cellules ont été lavées dans une solution saline tamponnée au phosphate (PBS) et fixées pendant 15 min dans du méthanol à -20°C. Après blocage dans du PBS contenant 10 % de sérum de veau foetal, des anticorps primaires dilués dans une solution de blocage ont été appliqués. Ceux-ci comprenaient les anticorps monoclonaux SV5 (1/10000) pour le tag SV5 et anti-FLAG M2 (1/1000 Stratagene) et polyclonal anti-GFP (1/500 Research Diagnostics, Flanders, NJ), anti-calréticuline (1/500 , Calbiochem, San Diego, CA) et anti-β-Cop (1/100 Affinity Bioreagents, Golden, CO). Après lavage dans plusieurs changements de PBS, des anticorps secondaires conjugués avec Alexa 488 ou Alexa 543 (Invitrogen) ont été appliqués à une dilution de 1/200. Après 20 min d'incubation, les lames ont été à nouveau lavées et montées dans du Mowiol (Sigma Chemical, Poole, Dorset, Royaume-Uni). Pour les études de localisation, CREB4 a également été cotransfecté avec un plasmide (enhanced yellow fluorescent protein [EYFP]-Golgi BD Biosciences Clontech), qui exprime le signal de ciblage Golgi de la -galactosyl transférase fusionné à la protéine fluorescente jaune. Les images de fluorescence ont été acquises sur un microscope confocal à balayage laser Zeiss LSM410. Les images ont été acquises en routine à l'aide d'un objectif à immersion dans l'huile Plan-apochromat 63×, d'une ouverture numérique de 1,4 et de facteurs de zoom allant de 1 à 8 du logiciel d'acquisition LSM 410.

    Dosages de la luciférase

    Les cellules COS ont été transfectées avec les différents vecteurs d'expression et cibles, et les lysats cellulaires ont été préparés 24 ou 48 h après la transfection par addition de tampon de lyse Glo (Promega, Madison, WI). L'activité luciférase de Firefly a été déterminée en utilisant le système de dosage Bright-Glo tel que décrit par le fabricant (Promega).

    Pour les expériences de fusion GAL4, 2 g du vecteur cible commercial contenant cinq sites de liaison GAL4, pFR-LUC (Stratagene), ont été cotransfectés avec différentes quantités (0, 0,25, 1 ou 4 g) de pM1 (vecteur vide exprimant l'ADN GAL4 domaine de liaison seul), pJS55 (GAL4-CREB4) ou pJS62 (GAL4-CREB4.ΔTMC1).

    Dans d'autres tests d'activation, l'activité du CREB4 natif et des variants a été comparée à celle de l'ATF6 en utilisant les vecteurs pJS23 (CREB4), pJS44 (CREB4.ΔTMC1, résidus 1-276), p3XFLAG-CMV-ATF6 et pCGNATF6 (1-373). Ces deux derniers vecteurs ont été aimablement fournis par le Dr Ron Prywes et ont été décrits précédemment (Wang et al., 2000). Ceux-ci ont été cotransfectés avec des vecteurs cibles contenant de multiples sites de liaison ATF6, 5XATF6-GL3 (2 ug), ou des vecteurs contenant les promoteurs natifs pour les chaperons ER tels que GRP78, le promoteur pGL3-GRP78 (0,5 ug). Ce vecteur, aimablement fourni par le Dr Mori (HSP Research Institute, Kyoto Research Park, Kyoto, Japon), a été décrit précédemment (Yoshida et al., 1998).

    Western Buvard

    Les cultures de cellules transfectées (1 à 2 × 10 5 cellules) ont été lavées dans du PBS froid, et les lysats totaux ont été préparés en ajoutant 200 µl de tampon de charge SDS. Les échantillons ont été brièvement soniqués et bouillis avant l'électrophorèse. Des quantités égales de protéines totales ont été fractionnées par SDS-PAGE et transférées sur des membranes Hybond-C (GE Healthcare, Little Chalfont, Buckinghamshire, Royaume-Uni). Les membranes ont été bloquées avec du PBS contenant 5 % de lait écrémé et 0,1 % de Tween 20. Les anticorps primaires dilués dans une solution de blocage étaient anti-SV5 (1/10000) et anti-FLAG M5 (1/1000 Sigma Chemical). Les bandes de protéines ont été détectées par des procédures standard pour la détection par chimiluminescence


    Les références

    Figure S1. La caractérisation d'un anticorps qui reconnaît les DCas et les mutants DCas présentent une formation musculaire normale et une détermination du devenir des cellules neuronales. (UNE,B) Caractérisation d'un anticorps généré contre un peptide p130Cas de mammifère hautement conservé qui reconnaît les DCas. Nous avons adopté plusieurs approches différentes pour caractériser un anticorps qui reconnaît Drosophile Cas. Nous avons d'abord tenté de générer des anticorps contre Cas en immunisant des souris avec un Drosophile Protéine de fusion Cas. Comme approche complémentaire, puisque les régions de Drosophile Les Cas étaient hautement conservés avec les Cas vertébrés et un certain nombre de Drosophile les protéines réagissent souvent de manière croisée avec les anticorps de mammifères (par exemple Colville et al. Miller et Benzer, 1983), nous avons obtenu tous les anticorps Cas de vertébrés publiés qui reconnaissaient un épitope hautement conservé dans Drosophile Cas. Nous avons ensuite pris notre pleine longueur Myc-tagged DCas, l'ont sous-cloné dans un vecteur d'expression de mammifère (pRK5), l'ont surexprimé dans des cellules de culture tissulaire et ont examiné nos antisérums DCas et les anticorps Cas vertébrés pour leur capacité à reconnaître les DCas sur un western blot. Nous avons essayé neuf anticorps différents disponibles dans le commerce et nos propres antisérums. Bien que notre Drosophile Cas antisera n'a pas reconnu Drosophile Cas, nous avons identifié un anticorps qui reconnaissait la surexpression Drosophile Myc DCas lorsqu'il est exprimé dans 293 cellules. (UNE) Les lysats de 293 cellules transfectées avec Myc DCas ont été examinés pour la présence d'une bande immunocolorée correspondant à la même taille que la protéine Myc DCas telle que visualisée avec un anticorps contre Myc (piste 1). Une bande (flèche) était présente dans les lysats de cellules 293 transfectées avec Myc DCas (piste 3) qui était absente dans les cellules 293 témoins (piste 2) lorsqu'elles étaient transférées avec l'anticorps phospho410-pl30Cas (Cas). Des bandes qui sont vraisemblablement des protéines Cas de mammifères endogènes sont également observées. (B) Drosophile embryons exprimant des DCas ( Myc DCas) ou des DCas dépourvus de domaine SH3 ( Myc-ΔSH3 DCas non publié) en utilisant le ELAV-GAL4 conducteur ou le DCas P1 - GAL4 La lignée mutante LOF a été génotypée et soumise à une analyse western avec des anticorps générés contre Myc ou Cas (phospho410-p130Cas). L'anticorps Myc reconnaît les Myc DCas exprimés dans tous les neurones en utilisant le ELAV-GAL4 conducteur (voie 1). L'anticorps phospho410-p130Cas reconnaît une bande de taille similaire lorsque Myc DCas est exprimé dans tous les neurones (piste 2). L'anticorps Myc reconnaît les Myc-DCas exprimés dans un DCas P1 fond mutant en utilisant le DCas P1 -GAL4 conducteur (voie 3). L'anticorps phospho410-p130Cas reconnaît les Myc DCas exprimées dans un DCas P1 fond mutant en utilisant le DCas P1 -GAL4 conducteur (voie 4). L'anticorps Myc reconnaît les DCas Myc-ΔSH3 exprimées dans un DCas P1 fond mutant en utilisant le DCas P1 -GAL4 conducteur (voie 5). L'anticorps phospho410-p130Cas reconnaît les DCas Myc-ΔSH3 exprimées dans un DCas P1 fond mutant en utilisant le DCas P1 -GAL4 conducteur (voie 6). Le poids moléculaire est donné en kDa. (C-E) Caractérisation d'une ligne de piège amplificateur exprimant DCas dans son modèle endogène. Pour caractériser davantage la distribution des protéines DCas, nous avons profité d'une ligne de piégeage d'amplificateurs d'éléments P dans laquelle un Gal4 l'élément promoteur est inséré dans le DCas gène en aval du site de démarrage de la traduction (DCas P1 -Gal4, voir la figure 1A). L'emplacement de DCas P1 -Gal4 suggéré que Gal4 pourrait être exprimé sous le contrôle de l'endogène DCas promoteur, permettant d'évaluer la distribution des protéines DCas. Pour tester cette idée, nous avons généré une version intégrale balisée par Myc DCas transgène sous le contrôle du promoteur UAS (UAS-Myc DCas). En utilisant le système Gal4-UAS, nous avons d'abord déterminé que lorsque UAS - Myc DCas a été exprimé dans tous les neurones en utilisant le pilote spécifique aux neurones Elav-Gal4, une immunocoloration Myc DCas a été observée dans le SNC et les axones moteurs tout au long de leurs trajectoires axonales et au niveau des sites d'innervation musculaire. (C) Une préparation filetée de stade 16/17 d'un embryon exprimant Myc DCas sous le contrôle du pan-neuronal ELAV-GAL4 promoteur (ELAV-GAL4/+ UAS- Myc DCas/+) immunocoloré avec des anticorps Myc montre que la conduite de l'expression de Myc DCas dans tous les neurones entraîne la localisation de Myc DCas dans les axones moteurs (astérisques) et dans les nerfs ISNb (flèches noires) et SNa (flèches vides). (D, E) Nous avons croisé notre UAS - Myc DCas ligne avec le DCas P1 -Gal4 et observé l'immunomarquage de Myc DCas dans les axones commissuraux et longitudinaux du SNC, dans les axones moteurs et à leurs sites d'innervation musculaire, et aux limites des segments dans les sites d'attache musculaire. (D) Un embryon de stade 15 exprimant Myc DCas sous l'endogène DCas promoteur, poussé par le DCas P1 Élément P GAL4 piège amplificateur (DCas P1 -GAL4/+ UAS- Myc DCas/+), immunocoloré avec un anticorps contre Myc. L'expression de Myc DCas est observée dans des groupes de neurones du SNC (n), dans les axones occupant les commissures antérieure (A) et postérieure (P), les connecteurs longitudinaux (L) et dans les racines nerveuses motrices (astérisques). (E) Expression de Myc DCas entraînée par l'endogène DCas Le promoteur est également observé au niveau des sites d'attache musculaire (têtes de flèches) et dans les nerfs ISNb innervant les muscles 6 et 7 (flèche). Ces résultats montrent que les Myc DCas exprimées dans le SNC en développement se localisent dans les projections du SNC et des axones moteurs, et soutiennent fortement l'idée que les DCas endogènes sont exprimées dans les neurones au cours du développement. (F-L) Formation musculaire normale et détermination du destin des cellules neuronales dans DCas mutants. 1 intégrine (le mien) les mutations nulles sont mortelles pour l'embryon et entraînent un détachement complet des muscles (Leptin et al., 1989 Wright, 1969). Dans 2 intégrine (si) mutants, les muscles se développent normalement jusqu'au stade 17, passé le point où les événements de guidage du moteur embryonnaire et des axones du SNC que nous évaluons ont eu lieu, puis se détachent de leurs sites d'attache musculaire mais restent toujours étirés (Hoang et Chiba, 1998 Prokop et al., 1998). Nous voyons des résultats similaires à l'occasion, nous avons vu des défauts dans la musculature sous-jacente comme jugé par l'optique Nomarski (par exemple dans 2 intégrine mutants) ces segments n'ont pas été inclus dans notre analyse des défauts de guidage axonal. Dans 1 intégrine (miauler) mutants, les muscles se développent et s'attachent normalement pendant l'embryogenèse, et les mutants meurent pendant les stades larvaires (Brower et al., 1995 Roote et Zusman, 1995). Étant donné que les DCas sont fortement exprimées au niveau des sites d'attachement musculaire en plus du système nerveux, nous avons examiné si des défauts dans l'organisation musculaire et/ou la détermination du destin des cellules neuronales pouvaient contribuer aux défauts de guidage axonal que nous observons dans DCas mutants. Type sauvage Drosophile les embryons présentent un schéma de muscles répétés segmentairement qui peut être visualisé avec l'anticorps myosine musculaire lorsqu'ils se fixent à l'épiderme au niveau des sites de fixation musculaire (Bate, 1993). (F-I) L'organisation des fibres musculaires dans Drosophile les embryons tels que visualisés avec un anticorps (FMM5) (Kiehart et Feghali, 1986) spécifique de la myosine musculaire dans lesquels des sites de fixation musculaire sélectionnés (entre les pointes de flèche) sont indiqués. (F-G) L'organisation normale des fibres musculaires telle que visualisée dans deux hémi-segments d'un embryon de type sauvage (F), et à une puissance plus élevée révélant les muscles 6, 7, 12 et 13 (G). (Salut dans DCas Mutants LOF, l'intégrité musculaire vue avec l'optique Nomarski montre que la formation musculaire n'a pas été perturbée (voir les figures 3 et 4). Un schéma normal des fibres musculaires est également observé dans DCas mutant LOF (DCas Df(3L)Exel6083 /DCas Df(3L)Exel6083 ) embryons colorés avec l'anticorps myosine musculaire (H), y compris la morphologie et l'attachement des muscles 6,7, 12 et 13 (I). Ces résultats sont cohérents avec notre capacité à sauver les défauts de guidage axonal observés chez les mutants DCas LOF avec une expression spécifique aux neurones de DCas (voir Fig. 3I, Fig. 4J et Fig. S2 dans le matériel supplémentaire). (J-L) Les défauts de guidage axonal peuvent également résulter d'une perte de neurones dans la corde nerveuse ventrale ou de changements dans la différenciation ou la spécification neuronale (Landgraf et al., 1999 Thor et al., 1999). Par conséquent, nous avons examiné l'organisation neuronale de la corde nerveuse ventrale dans DCas mutants. Aucune anomalie dans la morphologie cellulaire de la corde nerveuse n'a été observée chez les mutants DCas en utilisant l'anticorps Fas2 et l'imagerie Nomarski (données non présentées). Nous avons ensuite examiné DCas mutants pour la présence ou l'absence de motoneurones spécifiques.En particulier, puisque nous voyons des défauts de guidage axonal dans DCas mutants où les axones ISNb restent fasciculés avec les axones ISN, nous avons demandé si ces défauts de guidage axonal sont le résultat d'une conversion des neurones ISNb en neurones ISN. La protéine Even-skiped (Eve) est un excellent marqueur des neurones ISN puisqu'elle est exprimée dans environ 16 cellules par hémisegment abdominal, dont six des neurones (un aCC, un RP2, quatre neurones CQ/U) qui donnent naissance aux axones qui forment le nerf ISN (Doe et al., 1988 Landgraf et al., 1997 Landgraf et al., 1999 Patel et al., 1989). La modification des niveaux d'Eve affecte les trajectoires axonales de ces neurones (Doe et al., 1988 Landgraf et al., 1999). (J) Deux de ces neurones ISN (aCC, rouge RP2, vert) sont représentés schématiquement dans trois segments d'un type sauvage Drosophile embryon (pointes de flèche). (K) Un complément normal de neurones aCC (tête de flèche rouge) et RP2 (tête de flèche verte) se trouve dans DCas mutants (DCas Df(3L)Exel6083 /DCas Df(3L)Exel6083 ). (L) Embryons dans lesquels des niveaux élevés (+++) de Myc DCas sont exprimés dans tous les neurones en utilisant le ELAV-GAL4 pilote dans un arrière-plan de type sauvage (Neuronal DCas GOF voir Fig. 5, Fig. S2 dans le matériel supplémentaire et Tableau 1) montrent également le complément normal des neurones aCC (tête de flèche rouge) et RP2 (tête de flèche verte). Barres d'échelle : 20 µm en C 13 µm en D 7 µm en E en Sol, 10 µm pour F-I en J, 5 µm pour J-L.

    Figure S2. Cas est fortement exprimé dans la moelle épinière des mammifères et les mutants DCas présentent des défauts de guidage axonal du SNC. (A-E) Les protéines Cas sont fortement exprimées dans la moelle épinière des mammifères. L'immunocoloration de la moelle épinière du rat P0 a été réalisée en utilisant des approches standard (Terman et al., 2000). Des ratons PO ont été perfusés, la moelle épinière et la colonne vertébrale environnante ont été prélevées et des coupes ont été coupées à 20 um sur un cryostat. Les sections montées sur lame ont ensuite été immunocolorées avec un anticorps sélectionné comprenant un anticorps monoclonal généré contre p130Cas de rat (Clone 8G4-E8, 1:400 Upstate Biotechnology), un anticorps monoclonal généré contre Sin de souris (Clone 13, 1:400, BD Transduction Labs ) qui reconnaît également le Sin de rat, et les anticorps polyclonaux spécifiques de plusieurs formes phosphorylées sur la tyrosine de p130Cas : phospho-p130Cas (Tyr249), #4014, Lot#1, 1:100, Cell Signaling Technologies phospho-p130Cas (Tyr410), #4011, Lot n° 1, 1:200, Technologies de signalisation cellulaire). Anticorps supplémentaires générés contre des membres de la famille de protéines Cas, notamment anti-p130Cas monoclonal de souris (Clone 21, 1:400, BD Transduction Labs), anti-p130Cas monoclonal de souris (CAS-14, 1:400, Chemicon International), polyclonal de lapin anti-Cas (N-17, Lot#I101, 1:500 Santa Cruz Biotechnology), lapin polyclonal anti-phospho-p130Cas phospho-p130Cas (Tyr165), #4015, Lot# 1, 1:100, Cell Signaling Technologies et chèvre On a trouvé que les anti-p130Cas polyclonaux (S-20, Lot#B282, 1:100, Santa Cruz Biotechnology) donnaient des résultats similaires. (A-D) Coupes adjacentes prises aux niveaux lombo-sacrés d'une moelle épinière de rat P0 immunocolorée avec des anticorps qui reconnaissent différents membres de la famille Cas. DF, funiculus dorsal dLF, funiculus dorsolateral vLF, funiculus ventrolateral VF, funiculus ventral cc, canal central dr, racine dorsale nr, racine nerveuse. (A) Un anticorps monoclonal de rat qui reconnaît les trois membres de la famille Cas du rat (clone 8G4-E8) montre que les protéines Cas sont fortement exprimées dans la matière grise et blanche de la moelle épinière du rat. Des neurones immunocolorés étaient présents dans toutes les lames de Rexed. (B) Vue à haute puissance de la région décrite en A dans une section adjacente immunocolorée avec un anticorps polyclonal (phospho249-p130Cas) dirigé contre une forme phosphorylée de p130Cas. Les neurones marqués (pointes de flèches) et leurs processus (flèches) sont indiqués. (C) Vue à haute puissance de la région de la moelle épinière décrite en A à partir d'une section adjacente immunocolorée avec un anticorps polyclonal différent (phospho410-p130Cas) dirigé contre une forme phosphorylée de p130Cas. Lamina IX est montrée et contient ce qui est très probablement, en fonction de l'emplacement et de la taille du corps cellulaire, des corps cellulaires des motoneurones immunocolorés (dans le cercle de points noirs) et leurs axones (flèches). (D) Vue à haute puissance de la région de la moelle épinière décrite en A à partir d'une section adjacente immunocolorée avec un anticorps monoclonal spécifique de Efs/Sin (Clone 13). Une forte immunocoloration est observée dans le funicule ventral et des neurones immunocolorés sélectionnés sont indiqués (têtes de flèche flèche blanche, ligne médiane du SNC). (E) Les neurones du ganglion cervical supérieur (SCG) du rat ont été prélevés, dissociés et cultivés à l'aide de techniques standard (Qian et al., 1998). Les lysats de ces neurones SCG ont ensuite été collectés et exécutés sur SDS-PAGE et une analyse occidentale a été réalisée en utilisant des approches standard. Le western blot a ensuite été coloré en utilisant des anticorps qui reconnaissent p130Cas, CasL et Sin (Cas, N-17, 1:500 Santa Cruz Biotechnology). Cas, CasL et Efs/Sin (flèches) sont tous exprimés dans les neurones SCG. (F-P) DCas Les mutants LOF et GOF présentent des défauts de guidage axonal du SNC. (F) Dans le type sauvage et DCas Df(3L)Exel6083 /+ embryons, trois (marqués 1, 2, 3 en A) principaux faisceaux axonaux longitudinaux sont détectés avec l'anticorps 1D4. Ces étendues sont normalement régulièrement espacées et d'épaisseur relativement uniforme (les flèches vides en F, I et J pointent vers le troisième connecteur longitudinal). (G) Axones contribuant à la troisième longitudinale dans DCas Les embryons mutants LOF sont plus minces que la normale, discontinus et souvent absents (flèche). (H) Axones qui constituent le troisième longitudinal dans 1 intégrine (miauler Les mutants M6) sont soit d'apparence anormale, soit souvent absents (flèche). (I,J) L'expression des DCas sauve les défauts du SNC observés dans DCas mutants. (I) Expression de Myc DCas sous le DCas P1 -GAL4 conducteur restaure le troisième connecteur longitudinal dans DCas mutants (UAS - Myc DCas/+ Df(3L)ED201/DCas P1 ) (flèches ouvertes). (J) Expression neuronale de Myc DCas en utilisant le ELAV-GAL4 conducteur restaure également le troisième connecteur longitudinal dans DCas mutants (ELAV-GAL4/UAS - Myc DCas DCas Df (3L) Exel6083 /DCas Df(3L)Exel6083 ) (flèches ouvertes). (K-P) Surexpression de Myc DCas dans tous les neurones en utilisant le pan-neuronal ELAV-GAL4 conducteur affecte considérablement les trajectoires axonales du SNC. Trois niveaux différents de surexpression de Myc DCas ont été examinés : la surexpression utilisant une copie des deux Myc DCas journaliste et ELAV-GAL4 pilote (+ tableau 1), surexpression de deux copies des deux Myc DCas et ELAV-GAL4 (++), et surexpression de deux copies des deux Myc DCas et ELAV-GAL4 à température élevée (29°C) pour induire des niveaux d'expression de Myc DCas plus élevés (+++). (KL) L'examen des axones du SNC dans les embryons surexprimant les DCas dans tous les neurones à l'aide d'un marqueur qui marque tous les axones commissuraux et longitudinaux, BP102 (Seeger et al., 1993), révèle une différence marquée par rapport à l'apparence normale en échelle des axones du SNC observés dans les embryons de type sauvage. L'expression neuronale ectopique des DCas entraîne des connexions longitudinales perturbées et des commissures anormales, un phénotype assez similaire à celui observé en l'absence du récepteur Slit Roundabout (Robo) ou une signalisation accrue par le récepteur Netrin Frazzled/DCC (Bashaw et Goodman, 1999 Kidd et al., 1998 Seeger et al., 1993). (K) Dans un embryon de type sauvage, les axones traversent la ligne médiane dans les commissures antérieure (A) et postérieure (P), ici visualisées avec l'anticorps monoclonal BP102. (L) Surexpression de Myc DCas dans tous les neurones dans un arrière-plan de type sauvage en utilisant le ELAV-GAL4 conducteur à 29 o C (+++), entraîne un croisement accru et anormal des axones commissuraux (flèches) ainsi que des connecteurs longitudinaux (L) fins et perturbés. (M-P) Examen des connecteurs longitudinaux du SNC exprimant la Fascicline II, 1D4-positif dans DCas mutants GOF montre que, comme dans DCas Mutants LOF, le conjonctif longitudinal 1D4-positif le plus externe est plus mince dans certains segments, discontinu dans d'autres, et dans certains cas fusionné avec le fascicule longitudinal 1D4-positif médian. De plus, nous avons constaté que les connecteurs longitudinaux, qui sont normalement régulièrement espacés de chaque côté de la ligne médiane du SNC, convergeaient souvent vers cette barrière médiane répulsive. Nous avons en outre observé que les axones du conjonctif longitudinal médian croisaient et retraversaient souvent de manière aberrante la ligne médiane du SNC, et aussi que les trois conjonctifs longitudinaux se regroupaient parfois en un seul faisceau. Le calage des axones s'est également produit dans les conjonctifs longitudinaux et à mesure que les axones ont quitté le cordon nerveux ventral, entraînant des projections fusionnées anormales s'étendant loin du SNC. Par conséquent, DCas La GOF entraîne des défauts étendus de localisation des axones du SNC, dont la plupart sont compatibles avec une hyperfasciculation. (M-P) En particulier, suite à une expression neuronale élevée de Myc DCas (++ ou +++), les axones dans les trois connecteurs longitudinaux positifs 1D4 étaient anormalement fasciculés les uns avec les autres. Ces défauts comprenaient l'absence ou la perturbation des axones dans les troisièmes connecteurs longitudinaux (M, flèches), le croisement anormal des axones sur la ligne médiane (M, pointe de flèche ouverte), de gros faisceaux d'axones anormalement fasciculés (NO, petites flèches) et le décrochage de axones hyperfasciculés dans le SNC (O, pointe de flèche) ou en périphérie (N, P, pointes de flèche). Barres d'échelle : 40 µm en A 20 µm en B 20 µm en C, pour C,D 6 µm en F, pour F-J 13 µm en K, pour K-L15 µm en M, pour M-P.

    Bashaw, G.J. et Goodman, C.S. (1999). Récepteurs chimériques de guidage axonal : les domaines cytoplasmiques des récepteurs à fente et à nétrine spécifient l'attraction par rapport à la répulsion. Cellule97, 917-926.

    Baté, M. (1993). Le mésoderme et ses dérivés. Dans Le développement de Drosophila melanogaster, (éd. M. Bate et A. Martinez-Arias), pp. 1013-1090. Cold Spring Harbor, New York : Presse de Cold Spring Harbor.

    Brower, D.L., Bunch, T.A., Mukai, L., Adamson, T.E., Wehrli, M., Lam, S., Friedlander, E., Roote, C.E. et Zusman, S. (1995). Exigences non équivalentes pour l'intégrine PS1 et PS2 au niveau des attaches cellulaires chez la drosophile : analyse génétique de la sous-unité d'intégrine alpha PS1. Développement121, 1311-1320.

    Colville, T., Hingorani, R., Flores-Saaib, R., Kosman, D., Bier, E., Campos, R., Wilson, M., Stall, A. et Voland, J.R. Une approche protéomique pour identifier les anticorps anti-humains spécifiques à réaction croisée contre les protéines de la drosophile. www.bdbioscience.com/pdf/autre/991A.pdf.

    Doe, C. Q., Smouse, D. et Goodman, C. S. (1988). Contrôle du destin neuronal par le gène de segmentation de la drosophile même ignoré. La nature333, 376-378.

    Hoang, B. et Chiba, A. (1998). Analyse génétique sur le rôle de l'intégrine lors du guidage axonal chez la drosophile. J. Neurosci.18, 7847-7855.

    Kidd, T., Brose, K., Mitchell, K.J., Fetter, R.D., Tessier-Lavigne, M., Goodman, C.S. et Tear, G. (1998). Roundabout contrôle le croisement axonal de la ligne médiane du SNC et définit une nouvelle sous-famille de récepteurs de guidage conservés au cours de l'évolution. Cellule92, 205-215.

    Kiehart, D.P. et Feghali, R. (1986). Myosine cytoplasmique de Drosophila melanogaster. J. Cell Biol.103, 1517-1525.

    Landgraf, M., Bossing, T., Technau, G.M. et Bate, M. (1997). L'origine, l'emplacement et les projections des motoneurones abdominaux embryonnaires de la drosophile. J. Neurosci.17, 9642-9655.

    Landgraf, M., Roy, S., Prokop, A., VijayRaghavan, K. et Bate, M. (1999). même sauté détermine la croissance dorsale des axones moteurs chez la drosophile. Neurone22, 43-52.

    Leptin, M., Bogaert, T., Lehmann, R. et Wilcox, M. (1989). La fonction des intégrines PS au cours de l'embryogenèse de la drosophile. Cellule56, 401-408.

    Miller, C.A. et Benzer, S. (1983). Réactions croisées d'anticorps monoclonaux entre la drosophile et le cerveau humain. Proc. Natl. Acad. Sci. Etats-Unis80, 7641-7645.

    Patel, N.H., Schafer, B., Goodman, C.S. et Holmgren, R. (1989). Le rôle des gènes de polarité des segments au cours de la neurogenèse de la drosophile. Gènes Dev.3, 890-904.

    Prokop, A., Martin-Bermudo, M. D., Bate, M. et Brown, N. H. (1998). L'absence d'intégrines PS ou de laminine A affecte l'adhésion extracellulaire, mais pas l'assemblage intracellulaire, des hémiadherens et des jonctions neuromusculaires chez les embryons de drosophile. Dév. Biol.196, 58-76.

    Qian, X., Riccio, A., Zhang, Y. et Ginty, D.D. (1998). Identification et caractérisation de nouveaux substrats des récepteurs Trk dans les neurones en développement. Neurone21, 1017-1029.

    Roote, C.E. et Zusman, S. (1995). Fonctions des intégrines PS dans l'adhésion tissulaire, la migration et les changements de forme au cours du développement embryonnaire précoce chez la drosophile. Dév. Biol.169, 322-36.

    Seeger, M., Tear, G., Ferres-Marco et Goodman, C.S. (1993). Mutations affectant le guidage des cônes de croissance chez la drosophile : gènes nécessaires au guidage vers ou loin de la ligne médiane. Neurone10, 409-426.

    Terman, J.R., Wang, X.M. et Martin, G.F. (2000). Réparation de la moelle épinière sectionnée à différents stades de développement chez l'opossum nord-américain, Didelphis virginiana. Cerveau Res. Taureau.53, 845-855.

    Thor, S., Andersson, S. G., Tomlinson, A. et Thomas, J. B. (1999). Un code combinatoire LIM-homéodomaine pour la sélection de voies de motoneurones. La nature397, 76-80.

    Wright, T.R.F. (1969). La phénogénétique du myosphéroïde létal mutant embryonnaire chez D. melanogaster. J. Exp. Zool.143, 77-99.


    Voir la vidéo: Dessiner, croquer, schématiser une cellule (Février 2023).